ID: 1183399348

View in Genome Browser
Species Human (GRCh38)
Location 22:37592871-37592893
Sequence CTGTGGGGATTGAGAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183399348_1183399354 6 Left 1183399348 22:37592871-37592893 CCCTCTTTTCTCAATCCCCACAG No data
Right 1183399354 22:37592900-37592922 TCTCTCTCATGCTTGTTTCCAGG No data
1183399348_1183399355 7 Left 1183399348 22:37592871-37592893 CCCTCTTTTCTCAATCCCCACAG No data
Right 1183399355 22:37592901-37592923 CTCTCTCATGCTTGTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183399348 Original CRISPR CTGTGGGGATTGAGAAAAGA GGG (reversed) Intergenic
No off target data available for this crispr