ID: 1183400669

View in Genome Browser
Species Human (GRCh38)
Location 22:37602064-37602086
Sequence CAAGGTCTGACTACATGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183400669_1183400675 20 Left 1183400669 22:37602064-37602086 CCACACCATGTAGTCAGACCTTG No data
Right 1183400675 22:37602107-37602129 TTCTCAGATCTAAGGTCCTTGGG No data
1183400669_1183400674 19 Left 1183400669 22:37602064-37602086 CCACACCATGTAGTCAGACCTTG No data
Right 1183400674 22:37602106-37602128 CTTCTCAGATCTAAGGTCCTTGG No data
1183400669_1183400673 12 Left 1183400669 22:37602064-37602086 CCACACCATGTAGTCAGACCTTG No data
Right 1183400673 22:37602099-37602121 ATAAGCTCTTCTCAGATCTAAGG No data
1183400669_1183400676 21 Left 1183400669 22:37602064-37602086 CCACACCATGTAGTCAGACCTTG No data
Right 1183400676 22:37602108-37602130 TCTCAGATCTAAGGTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183400669 Original CRISPR CAAGGTCTGACTACATGGTG TGG (reversed) Intergenic
No off target data available for this crispr