ID: 1183400672

View in Genome Browser
Species Human (GRCh38)
Location 22:37602082-37602104
Sequence GCTTATGTAGATTCACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183400672_1183400677 15 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400677 22:37602120-37602142 GGTCCTTGGGGAGCTAGAGCAGG No data
1183400672_1183400675 2 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400675 22:37602107-37602129 TTCTCAGATCTAAGGTCCTTGGG No data
1183400672_1183400674 1 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400674 22:37602106-37602128 CTTCTCAGATCTAAGGTCCTTGG No data
1183400672_1183400676 3 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400676 22:37602108-37602130 TCTCAGATCTAAGGTCCTTGGGG No data
1183400672_1183400679 19 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400679 22:37602124-37602146 CTTGGGGAGCTAGAGCAGGCAGG No data
1183400672_1183400680 28 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400680 22:37602133-37602155 CTAGAGCAGGCAGGAACAGTTGG No data
1183400672_1183400673 -6 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400673 22:37602099-37602121 ATAAGCTCTTCTCAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183400672 Original CRISPR GCTTATGTAGATTCACCTCA AGG (reversed) Intergenic
No off target data available for this crispr