ID: 1183400675

View in Genome Browser
Species Human (GRCh38)
Location 22:37602107-37602129
Sequence TTCTCAGATCTAAGGTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183400671_1183400675 15 Left 1183400671 22:37602069-37602091 CCATGTAGTCAGACCTTGAGGTG No data
Right 1183400675 22:37602107-37602129 TTCTCAGATCTAAGGTCCTTGGG No data
1183400669_1183400675 20 Left 1183400669 22:37602064-37602086 CCACACCATGTAGTCAGACCTTG No data
Right 1183400675 22:37602107-37602129 TTCTCAGATCTAAGGTCCTTGGG No data
1183400672_1183400675 2 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400675 22:37602107-37602129 TTCTCAGATCTAAGGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183400675 Original CRISPR TTCTCAGATCTAAGGTCCTT GGG Intergenic
No off target data available for this crispr