ID: 1183400676

View in Genome Browser
Species Human (GRCh38)
Location 22:37602108-37602130
Sequence TCTCAGATCTAAGGTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183400671_1183400676 16 Left 1183400671 22:37602069-37602091 CCATGTAGTCAGACCTTGAGGTG No data
Right 1183400676 22:37602108-37602130 TCTCAGATCTAAGGTCCTTGGGG No data
1183400672_1183400676 3 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400676 22:37602108-37602130 TCTCAGATCTAAGGTCCTTGGGG No data
1183400669_1183400676 21 Left 1183400669 22:37602064-37602086 CCACACCATGTAGTCAGACCTTG No data
Right 1183400676 22:37602108-37602130 TCTCAGATCTAAGGTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183400676 Original CRISPR TCTCAGATCTAAGGTCCTTG GGG Intergenic
No off target data available for this crispr