ID: 1183400680

View in Genome Browser
Species Human (GRCh38)
Location 22:37602133-37602155
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183400672_1183400680 28 Left 1183400672 22:37602082-37602104 CCTTGAGGTGAATCTACATAAGC No data
Right 1183400680 22:37602133-37602155 CTAGAGCAGGCAGGAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183400680 Original CRISPR CTAGAGCAGGCAGGAACAGT TGG Intergenic
No off target data available for this crispr