ID: 1183401564

View in Genome Browser
Species Human (GRCh38)
Location 22:37608092-37608114
Sequence GTGTGATAGGGGAAGCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183401564_1183401569 -7 Left 1183401564 22:37608092-37608114 CCCGTGGGCTTCCCCTATCACAC No data
Right 1183401569 22:37608108-37608130 ATCACACTGTAATAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183401564 Original CRISPR GTGTGATAGGGGAAGCCCAC GGG (reversed) Intergenic
No off target data available for this crispr