ID: 1183402505

View in Genome Browser
Species Human (GRCh38)
Location 22:37612942-37612964
Sequence CTGAATCCAGAAATGGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183402505 Original CRISPR CTGAATCCAGAAATGGATAG TGG (reversed) Intronic
902283160 1:15389011-15389033 CTTAATCCAGGGATGGATTGTGG + Intronic
904557093 1:31372553-31372575 CTGAACCCAGAAAGGGAATGGGG - Intronic
904588787 1:31595859-31595881 CTGAATACAGAATGGGAAAGTGG - Intergenic
904747856 1:32721965-32721987 ATGAATGCAGAAATGAGTAGTGG - Intergenic
905513376 1:38542343-38542365 CAGACTCCAGAAATGGGAAGGGG - Intergenic
905681295 1:39873527-39873549 TTGAATCCTGAAATGGAAAAGGG + Intronic
905832084 1:41077727-41077749 CTCAATCCAGAATTAGATTGAGG + Intronic
907383017 1:54107078-54107100 CTGAATCCTGAAACAGAAAGAGG - Intronic
908816608 1:68041970-68041992 ATGATTCCAGACATGGATGGAGG - Intergenic
909014069 1:70364635-70364657 CTGAACCCAAATATGGCTAGTGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
910030482 1:82715653-82715675 CTGATTCCAGAAGTGGAGTGAGG - Intergenic
910385375 1:86676993-86677015 CTCAATGGAAAAATGGATAGAGG + Intergenic
911132988 1:94409747-94409769 CAGAATCCAGAATCAGATAGTGG + Intergenic
911315551 1:96352801-96352823 TTGAATCCAGAAGTGGTTAAGGG + Intergenic
911565369 1:99457411-99457433 CTGAATGTAGTAATGGATTGAGG - Intergenic
911626167 1:100127049-100127071 GAGAATCCAGAATTGGACAGAGG + Intronic
911887318 1:103320439-103320461 CTGAATCAAGAATTGGAGACTGG - Intergenic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
912875648 1:113356102-113356124 CTTATTCCAGAAAGGAATAGAGG - Intergenic
914927766 1:151903786-151903808 CTGTATCCATAAAAGGACAGTGG - Intronic
916071582 1:161173333-161173355 CGGATTCCAGAACTGGAAAGGGG - Intronic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918563834 1:185902139-185902161 CTCAATTCATAAATGGATATAGG - Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
921613415 1:217238339-217238361 CTGAATGCAGGATTGGAAAGGGG - Intergenic
1063594824 10:7424721-7424743 CTGAAACCTGAAGGGGATAGAGG - Intergenic
1066236183 10:33487030-33487052 CTGAATGCAGAGATGGTTAGAGG - Intergenic
1068205912 10:53852978-53853000 CTCATCCCAGACATGGATAGGGG + Intronic
1069057991 10:63864856-63864878 CTGAAACTAGAAATGGGCAGTGG - Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1071538113 10:86453336-86453358 CTGAAATAAGAAATGGATACAGG + Intronic
1073901203 10:108223235-108223257 CTAAATGGAGAAATGGAAAGAGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075246035 10:120822905-120822927 CTGAATCAATGAATGGGTAGTGG - Intergenic
1076746060 10:132515124-132515146 CCGAATCCAGGCAGGGATAGTGG - Intergenic
1079608136 11:22395666-22395688 CTAAAAACAGAAATGGATACTGG + Intergenic
1079624030 11:22593804-22593826 CTGAGTCCAGAAATTGCTAAGGG - Intergenic
1079680539 11:23291258-23291280 CTGACTCCAGAAATGAGTATGGG + Intergenic
1081349548 11:42033389-42033411 CTAAATTAAGAAATGCATAGAGG - Intergenic
1085429689 11:76437333-76437355 ATGAACCCAGAAATGGAGAAAGG - Intergenic
1087283075 11:96233957-96233979 CTGAGGCAAGAAATGGAGAGAGG - Intronic
1088008617 11:104972363-104972385 CTCAATACAGAAATGAAAAGCGG + Intergenic
1088228673 11:107650229-107650251 TTGAATCCAGAGATGGATACTGG - Intronic
1089985554 11:122809630-122809652 TTGCAGTCAGAAATGGATAGTGG - Intronic
1092238275 12:6822859-6822881 AAGCATCCAGAAATGGAAAGAGG - Intronic
1092999843 12:13983848-13983870 CTGAATACAGAAAATGAGAGTGG - Intergenic
1093016257 12:14157379-14157401 CTGAAACCTGAACTGGAGAGAGG + Intergenic
1096154019 12:49331870-49331892 CTGAATCCTGAAAGGGAAGGAGG + Intergenic
1096583300 12:52602127-52602149 CTTAGTCCAGAAATGCTTAGTGG - Intergenic
1096668348 12:53181654-53181676 CTGAAACCAGAAAGGAAGAGGGG - Intronic
1097524384 12:60711970-60711992 CTGTTTCCAGAACTGGATATTGG + Intergenic
1097788027 12:63782661-63782683 CAGAAGCCAGAAATGGAGATGGG - Intronic
1101475411 12:105042129-105042151 CTAAATAAAGAAATGGATATAGG - Intronic
1101699290 12:107156728-107156750 CGGAATCTAGACATGGATGGTGG + Intergenic
1102222956 12:111206947-111206969 ATGAATGCATAAATGGATGGTGG + Intronic
1102861121 12:116337403-116337425 CTGAATCCAGTAGTGGAAAGGGG + Intergenic
1104173839 12:126309702-126309724 CTGAAGCCAGAGATGGTAAGTGG - Intergenic
1105542157 13:21325218-21325240 CTGAAACCAGTGATGGGTAGAGG - Intergenic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1109306925 13:60651194-60651216 CTGAATTCAGAAAGGGTAAGAGG + Intergenic
1112558377 13:100490066-100490088 CAGAATGCAGAAATAGACAGAGG - Intronic
1112837180 13:103530389-103530411 CTGGATCCAGAAGTGGTTAAAGG + Intergenic
1113373055 13:109740096-109740118 CTGAATCCTGAAACTGAAAGAGG - Intergenic
1113827601 13:113268460-113268482 CTGAATTCAGAAAGGGCTGGAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1117168737 14:53068132-53068154 CTGGATCCTGTACTGGATAGGGG - Intronic
1117872500 14:60215999-60216021 CTTAAGCCAGAAATGAAAAGAGG + Intergenic
1119951675 14:78751921-78751943 CTGAACCAGGAAATGGATAGAGG + Intronic
1120179811 14:81331651-81331673 CTAAATCCAGCCATGGATAGAGG + Intronic
1122456354 14:101855299-101855321 CTGAATGCAGAAGCGGACAGGGG - Intronic
1123910221 15:24958452-24958474 TAGCATCCAGAAATGGAGAGAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126209330 15:46082051-46082073 CTGAAGGCAGTAATGGTTAGTGG - Intergenic
1127842718 15:62844929-62844951 CTGAATACAGAAGTGCATATGGG + Intergenic
1133140079 16:3737233-3737255 CTGAAACTTGAAAAGGATAGGGG - Intronic
1134632236 16:15765157-15765179 ATGAATGAATAAATGGATAGAGG + Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137433162 16:48434616-48434638 CTGGACCCAGAAATGGACCGGGG - Intronic
1139211259 16:65079629-65079651 CTGAATCAAGAAAGGTAGAGAGG - Intronic
1139452050 16:67036317-67036339 TTAAATGCAGAGATGGATAGTGG + Intronic
1141740050 16:85885116-85885138 CTGAATCCAGAGATGGGGGGTGG - Intergenic
1143270522 17:5671685-5671707 CTGTGTCCAGCAATGGAGAGGGG - Intergenic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1144520986 17:15952044-15952066 CTGAATTCTGAAAAGGACAGTGG + Intronic
1147117309 17:38311107-38311129 CAAAATCTGGAAATGGATAGTGG - Intronic
1148412373 17:47478479-47478501 CAAAATCTGGAAATGGATAGTGG + Intergenic
1151053407 17:71005134-71005156 GTGATTCAACAAATGGATAGTGG + Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1153909411 18:9693749-9693771 CAGAATCCAGAGTTGGAAAGGGG + Intergenic
1153992144 18:10410093-10410115 CTGAACTCAGAGGTGGATAGGGG + Intergenic
1155172311 18:23275998-23276020 AAGATTCCAGAAATGGATGGTGG + Intronic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1156471631 18:37380717-37380739 CTGGATGGATAAATGGATAGAGG - Intronic
1157691850 18:49689687-49689709 ATGAATACAGAAATTAATAGAGG + Intergenic
1158271607 18:55722430-55722452 TTGAATCTAAAAATGGATTGTGG - Intergenic
1158424836 18:57329619-57329641 CTGAAACCAGAGATGGGTTGGGG + Intergenic
1158472764 18:57752301-57752323 CAGAATCAAGAAATGGTTAAGGG + Intronic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1165828624 19:38719637-38719659 GTGAATCCGGGAATGGATGGAGG - Intronic
1166724057 19:45014879-45014901 CTGAATCCAGATTTGGAGACAGG - Intronic
1167216254 19:48167411-48167433 CTGATTCCAGAAAACGAAAGGGG - Intronic
1168653567 19:58110416-58110438 CTGAATCCAGACATGCATACTGG + Intronic
927700828 2:25267839-25267861 TTAAATGCAGAAATGGGTAGAGG + Intronic
929442560 2:41976105-41976127 CTGAATGCAGAATTGGGAAGAGG + Intergenic
930500702 2:52213918-52213940 CTGAATCCATAAATGGCAGGTGG + Intergenic
930900893 2:56506702-56506724 CTGCCTCCAGAAATGGAGTGTGG + Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932166209 2:69509807-69509829 GTGACTCCAGAAATAGAAAGTGG - Intronic
933136363 2:78740817-78740839 GTGAATCCTGGAATGGATTGTGG + Intergenic
935839600 2:107094789-107094811 CTGAACCTGGAAATGGATATGGG + Intergenic
938847287 2:135222618-135222640 CTGAACGCAGAGATGGATATGGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939088083 2:137745595-137745617 CAGAACACAGAAATGGACAGAGG + Intergenic
943010665 2:182444235-182444257 ATGAAGCCAGAAATGGCTGGGGG - Intronic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945841717 2:214894858-214894880 CATAATCCAGAAATAGAAAGGGG - Intergenic
946759899 2:222983121-222983143 CTGAATGCAGATATGCATAGAGG + Intergenic
1168786762 20:546025-546047 CTGAATGAAGTCATGGATAGAGG - Intergenic
1170792694 20:19521047-19521069 CAAAATCCAGAAATAGACAGTGG - Intronic
1171024742 20:21619667-21619689 GTGATCCCAGAAATAGATAGAGG - Intergenic
1174385857 20:50188415-50188437 CAGAATCCAGAAAGGGAACGTGG + Intergenic
1175221195 20:57417466-57417488 ATGAATGGAGAAACGGATAGAGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1183402505 22:37612942-37612964 CTGAATCCAGAAATGGATAGTGG - Intronic
1185419438 22:50727318-50727340 CTGGATCCAGAAATGGCAAGGGG + Intergenic
950482999 3:13256183-13256205 CTGAGTCTAGAGACGGATAGTGG + Intergenic
952854497 3:37757935-37757957 CAGAAACCAGAAATGGAGAGCGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
954700086 3:52446379-52446401 CTCAATCCTGAAATGGAAACAGG + Intergenic
956035896 3:65091566-65091588 CAGAATCAAGAAATGGTAAGAGG + Intergenic
956590042 3:70905054-70905076 CTGAATCCAGAAGTGCATTTAGG + Intergenic
958486830 3:94723056-94723078 CTGAATCCAGAAATCTATCTTGG - Intergenic
962039146 3:131686593-131686615 AGGAAATCAGAAATGGATAGGGG - Intronic
964254074 3:154754923-154754945 CTGAAGCCAGAAATGAAAAAAGG + Intergenic
965127920 3:164653573-164653595 CTGCATCCAGAAATGGGAAGGGG + Intergenic
965396629 3:168166911-168166933 CTAAATGTAGAAATGGAGAGTGG + Intergenic
966562454 3:181338257-181338279 CTGAATGTAGAAATGGTTTGTGG + Intergenic
971652909 4:29302671-29302693 CTTAATGCAGAACTGGACAGTGG + Intergenic
973633824 4:52843694-52843716 GTGACTCTAGACATGGATAGTGG - Intergenic
973807080 4:54536786-54536808 CTGAATCTTGACATGAATAGAGG - Intergenic
982661125 4:158208369-158208391 CTGGAGCCAGTAAAGGATAGGGG - Intronic
986772313 5:10985428-10985450 ATGAATCCAGAAAAGGAGGGTGG + Intronic
988655037 5:33201354-33201376 CAGAGTCCAGAAATAGATAGGGG + Intergenic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
990492292 5:56314409-56314431 CTGAATCCATATATGGAAAGAGG + Intergenic
991101525 5:62798684-62798706 CTGAATGCATAAATGCATAGTGG + Intergenic
991234886 5:64382109-64382131 CTGAATGCAAAAATGAATTGGGG - Intergenic
992159154 5:73983800-73983822 CTGAATCCAGCCATGGAAAGAGG + Intergenic
992880425 5:81103471-81103493 CTCATTCCAGAAATGTATATTGG - Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997813631 5:136995885-136995907 CAGAAACCCGAAATGGAAAGAGG + Intronic
1000894555 5:166839871-166839893 CTGAATCCAGAAATGCTAATTGG + Intergenic
1000966553 5:167664479-167664501 CTGAAAGCAGAAATGAAAAGAGG + Intronic
1003409980 6:5853576-5853598 CTGAAACCAGTGATGGGTAGAGG + Intergenic
1009310355 6:62143321-62143343 CTGAACTCAGAAATGAATATAGG + Intronic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1013699087 6:112741475-112741497 CTGAAGCCAGAAAGCGTTAGTGG - Intergenic
1015921205 6:138268109-138268131 CTCAGTCCAGAGATGGATACAGG - Intronic
1015932686 6:138377618-138377640 CAGAATCCAGAAATAATTAGTGG + Intergenic
1018162101 6:161054896-161054918 CTGGGTCCACAAATGGATATGGG - Intronic
1018606374 6:165602075-165602097 GTGAAAACAGAAATGGACAGTGG - Intronic
1020549189 7:9577819-9577841 CTGAATCCTAAAATGGAAATTGG - Intergenic
1022725358 7:32976400-32976422 CTGATTCCTGGAATGGATAAAGG + Exonic
1022749479 7:33208767-33208789 CTGAATTCAGAAAATAATAGTGG - Intronic
1022786144 7:33639310-33639332 CTGAAGCAATAAATGGAAAGAGG - Intergenic
1023603096 7:41899891-41899913 CTGAATACAAAAATCCATAGAGG + Intergenic
1024325697 7:48107600-48107622 CAGAAACCAGAAATGGGTATCGG - Intronic
1024765144 7:52648980-52649002 ATAAATCTGGAAATGGATAGTGG - Intergenic
1025048254 7:55711440-55711462 CTGATTCCTGGAATGGATAAAGG - Intergenic
1030308598 7:108045993-108046015 CAAAATCCAGTAAAGGATAGAGG - Intronic
1030898230 7:115088331-115088353 CTGATGCCAGAAATGTTTAGAGG - Intergenic
1030915564 7:115308346-115308368 GTGAATCCTGAAATGGATTCTGG + Intergenic
1033285675 7:140038847-140038869 CTGAGTCCAGCAATGGAGAAGGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038949314 8:32396962-32396984 CGGAATTGGGAAATGGATAGAGG - Intronic
1041983902 8:63896294-63896316 CTGAAACCAGAAACTGACAGTGG + Intergenic
1043392189 8:79802524-79802546 ATGAATCCAGACATGGCCAGTGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045454723 8:102366434-102366456 CTGTATCCAGAAAAGCAGAGGGG - Intronic
1047237578 8:123055682-123055704 CTGAATGCAGAGTTGGACAGAGG - Intronic
1048583336 8:135749483-135749505 ATGACCCCAGAAATGGTTAGGGG + Intergenic
1048982352 8:139709589-139709611 ATGAATCCAAAAATGGCAAGAGG + Intergenic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1050226135 9:3457623-3457645 CTGAATCCTAAAATGAATTGAGG - Intronic
1050279323 9:4033907-4033929 CTGAACCCAGAAATGCAGATAGG - Intronic
1051576728 9:18624333-18624355 TGGAAACCAGAAATGGATAGAGG + Intronic
1051871726 9:21745746-21745768 TTGAATACAGATATGTATAGAGG + Intergenic
1053277060 9:36791063-36791085 AGGCATCCAGTAATGGATAGTGG - Intergenic
1056429425 9:86512382-86512404 CTGAGCCAAGAAATGGATAATGG + Intergenic
1056972627 9:91219974-91219996 TTGACTCTAGAAATGGTTAGGGG + Intronic
1058276924 9:103054827-103054849 CTGAAGCCATAAAATGATAGGGG + Intergenic
1058534293 9:105940668-105940690 CAGAGTCCGGAAATGGGTAGGGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1059767740 9:117399920-117399942 ATGAATACAGAAGTGGACAGTGG + Intronic
1061490883 9:130943683-130943705 CTGGAGCCAGAAATGTACAGTGG + Intergenic
1061499277 9:130992906-130992928 CTGAAACCAGAACTGGGTAGGGG + Intergenic
1062099013 9:134718366-134718388 CAGAATCCAGGAATGTAAAGGGG + Intronic
1186387063 X:9120715-9120737 TGGAATCCAGAGCTGGATAGAGG - Intronic
1187647662 X:21366637-21366659 CTGTATCCAGAAAGAGAGAGAGG - Intergenic
1189944301 X:46162510-46162532 CTGAATGCAGAATTGGGAAGAGG - Intergenic
1193132039 X:77930555-77930577 CTCAATACTGAAATGCATAGTGG + Intronic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1198665567 X:139018539-139018561 CAAAATCCACAAAGGGATAGAGG + Intronic
1199943682 X:152648986-152649008 CTGAATGCAGAGACGGAAAGGGG - Intronic
1201579477 Y:15495690-15495712 CTGAATACAGCATTGGAAAGTGG + Intergenic