ID: 1183402677

View in Genome Browser
Species Human (GRCh38)
Location 22:37613875-37613897
Sequence GTTCTCAGCAGAATCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183402674_1183402677 15 Left 1183402674 22:37613837-37613859 CCTCTGAGCATAAATTTCATGAG No data
Right 1183402677 22:37613875-37613897 GTTCTCAGCAGAATCAGAGGAGG 0: 1
1: 0
2: 2
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183402677 Original CRISPR GTTCTCAGCAGAATCAGAGG AGG Intronic
900965139 1:5952526-5952548 CTCCTCAGCAGCATCAGATGCGG + Intronic
903713380 1:25343696-25343718 ATTTTCAGCAGAGTCAGAGAAGG + Intronic
903744871 1:25580151-25580173 GTTCTCCGCAGATTCAGGGTAGG + Intergenic
904967654 1:34390872-34390894 TTTCTCAGCAGAAACAAGGGAGG - Intergenic
905955878 1:41995315-41995337 CTTCCCAGCAGAAACAGTGGAGG + Intronic
906252803 1:44324242-44324264 ACTCTCCGCAGAATCAGAGAGGG + Intronic
909999052 1:82320167-82320189 TTTCTCAGTGGATTCAGAGGAGG + Intergenic
911124678 1:94330135-94330157 GTTCTCAGAAACAGCAGAGGGGG - Intergenic
912191344 1:107344479-107344501 CTTCTCAGCAGAATCCTATGGGG + Intronic
912585256 1:110757975-110757997 GTTTTAAGGAGACTCAGAGGTGG - Intergenic
915504816 1:156347509-156347531 GCTCTCATCAGAAGCAGATGTGG - Intronic
916210521 1:162356408-162356430 GTTCTCACCAGAGGCAGTGGAGG + Intronic
917469820 1:175316725-175316747 GTCCCCAACAGAATGAGAGGGGG - Exonic
917875070 1:179279090-179279112 CTTCTCATCAGAATCAATGGGGG - Intergenic
918121338 1:181543585-181543607 GTTCTCTGCAGACTGAGAAGAGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921299721 1:213739096-213739118 TATCTCAGCAGAGGCAGAGGTGG - Intergenic
921327742 1:214004214-214004236 CTCCTCAGCAGACTCAGAGCTGG - Intronic
922019778 1:221691879-221691901 GTTCTCCACAGAAAGAGAGGGGG + Intergenic
922690884 1:227689488-227689510 TTTCTCAGCAAAATAAAAGGTGG + Intergenic
922812754 1:228426940-228426962 GCCCTCACCAGAAGCAGAGGTGG + Intergenic
923476508 1:234337436-234337458 TTTCTCATCAGAAACAGTGGAGG + Intergenic
924790165 1:247238807-247238829 CTGCTCAGCAGAATCAGACCAGG + Intergenic
1063876120 10:10480520-10480542 GTCCTTAGTAGAATCACAGGGGG + Intergenic
1064473739 10:15664095-15664117 ATTCTCAGAAGAATCTTAGGAGG + Intronic
1065853505 10:29811305-29811327 ATTCTCAGCAGAGAGAGAGGAGG + Intergenic
1067732247 10:48820683-48820705 GTTCTCAGGAGAAGCAGGGAGGG + Intronic
1067842804 10:49695233-49695255 GTCCTCAGCAGAATGTGAGATGG + Intronic
1068822877 10:61398305-61398327 TTTCTCAGCATAATCAGAATGGG - Intergenic
1070113436 10:73506637-73506659 GTTCCCAGATGAATCTGAGGTGG - Intronic
1070395418 10:76007774-76007796 TTTATCGTCAGAATCAGAGGAGG + Intronic
1070665915 10:78343241-78343263 GTTATCTGCAGAATCCCAGGTGG + Intergenic
1070978819 10:80628092-80628114 GTGCTCAGAAGAAGCAGAGGTGG + Intronic
1071495669 10:86165916-86165938 GTTCCCACCACAATCGGAGGAGG + Intronic
1072864167 10:99041351-99041373 ATTGTCAGCAGAACCAGGGGAGG + Intronic
1073204517 10:101761862-101761884 GGCCTCAGCAGAGTCAGAGAAGG - Intergenic
1073309347 10:102528689-102528711 ATTCTCAGCCGAATCAGTGCTGG + Intronic
1074776768 10:116773001-116773023 CTTCTCAGAAGAACCACAGGTGG - Intergenic
1076447882 10:130530850-130530872 GTTCTCAGCAGTAACAAGGGGGG - Intergenic
1077356362 11:2120725-2120747 GTTCTCTGCAGAGTCGGTGGAGG - Intergenic
1079111132 11:17605846-17605868 GTTCTCTGCAGACCCAGATGTGG + Exonic
1079540689 11:21570643-21570665 GTTTTGAACAGAATGAGAGGTGG + Intronic
1080093970 11:28382504-28382526 GTTCCCAGCAGATTGAGGGGAGG + Intergenic
1081656065 11:44858348-44858370 GTTATCAGGGGAATTAGAGGAGG + Intronic
1081738291 11:45420488-45420510 GCTCCCAGCAGATTCAGAGGAGG + Intergenic
1083978779 11:66147159-66147181 CTTCTCAGCAGAAACAGTGTAGG + Intronic
1084205552 11:67589813-67589835 GAAGTCAGCAGATTCAGAGGAGG - Intergenic
1084776021 11:71376166-71376188 GTTCTCAGCAAACTCAGGGAGGG - Intergenic
1085737651 11:79053363-79053385 GTTCTTACCTGAATCAGAGAAGG + Intronic
1086565040 11:88215963-88215985 GTTCTCACCAGAAGCAGATGCGG + Intergenic
1088696373 11:112369730-112369752 GATCCCAGCAGAATCTGATGAGG + Intergenic
1092730920 12:11533652-11533674 GTCCTCACCAGAAGCAGATGCGG - Intergenic
1093201121 12:16187429-16187451 GTTGTGAACAGAATCAGATGGGG + Intergenic
1093669922 12:21861670-21861692 ATTCTGAGAAGTATCAGAGGAGG + Intronic
1096664819 12:53157081-53157103 GGTCTCAGCTGTCTCAGAGGAGG - Intergenic
1097237520 12:57550181-57550203 GCTCTCAGCAGAGGCCGAGGCGG - Exonic
1101400035 12:104379238-104379260 GTGGGCATCAGAATCAGAGGAGG + Intergenic
1103861237 12:124015977-124015999 GCTGTCAGCTGAAGCAGAGGGGG + Intronic
1106277767 13:28230002-28230024 GCTCTCAGCAGATTAGGAGGAGG - Intronic
1106649635 13:31676357-31676379 GTACTCTGCAAAAACAGAGGAGG + Intergenic
1106909455 13:34447973-34447995 GTTCTGAGCTGATTCAGAGGAGG - Intergenic
1109459852 13:62642374-62642396 TTTCTCAGCAGAAACAACGGAGG + Intergenic
1110024962 13:70525397-70525419 GTTCTCAGAAGCAACAGAGTGGG + Intergenic
1111599346 13:90451790-90451812 TATCTCAGGAGAAGCAGAGGTGG - Intergenic
1114650300 14:24280465-24280487 GTTCACAGCAGGAGCAGAAGTGG - Intergenic
1116579023 14:46614830-46614852 GTTCACAGTAGAATTAGAAGTGG - Intergenic
1116641421 14:47468508-47468530 GTCCTCATCACAATCAGAGTTGG - Intronic
1119913319 14:78371383-78371405 GCTCTCAGCAGAAGGGGAGGTGG - Intronic
1123113907 14:105885258-105885280 GTCCTCAGCAGCATCACAGCGGG - Intergenic
1123794994 15:23762340-23762362 GGTCACAGCAGAAGCAGGGGTGG + Intergenic
1123986647 15:25652436-25652458 GTTGTCAGCAGAATCAAAGGAGG - Intergenic
1124721882 15:32117601-32117623 GTTCTCAGCCAGAGCAGAGGAGG + Intronic
1125157673 15:36607353-36607375 GTTCACAGGAGAATACGAGGAGG + Intronic
1126204967 15:46035144-46035166 GTTCTCACCAGAAGCCAAGGAGG + Intergenic
1127276744 15:57452716-57452738 CTTCTCTGTAGACTCAGAGGAGG - Intronic
1128101795 15:65007189-65007211 GCTCTCAGCAAAAAAAGAGGGGG - Intronic
1128516798 15:68347267-68347289 GATGCCAGGAGAATCAGAGGCGG - Intronic
1129127580 15:73457360-73457382 GTACTCAGCTGAAGCAGAGGAGG + Intronic
1129323880 15:74789460-74789482 GTCCTCTGCAGAACCAGAGGTGG + Intronic
1129542566 15:76362867-76362889 GGTCTTAGCAAAATCAGAAGAGG - Intronic
1130792262 15:87168109-87168131 GTATTCAGCAGCATCAGAGGAGG + Intergenic
1131398330 15:92104553-92104575 GTTCTGAGCAGAGGCAGATGAGG - Intronic
1133949228 16:10376404-10376426 TTTCTCAGCAGAAACCAAGGAGG - Intronic
1134135016 16:11672083-11672105 GTTCTCAGGGGGATCATAGGTGG - Intronic
1134378440 16:13701517-13701539 ATTTTCAGCAGAACCAGATGTGG + Intergenic
1134423983 16:14121367-14121389 ATTCTCAGCAGAAGCAGAAGTGG - Intronic
1135143992 16:19945753-19945775 GTACTCAGGAGAGTCAGAGAAGG + Intergenic
1135459378 16:22628232-22628254 GATCTTAGTAGAATCACAGGTGG + Intergenic
1136270732 16:29146801-29146823 GTTCTCTGGGGAAACAGAGGTGG - Intergenic
1138237670 16:55398756-55398778 GTCCTCGGTAGAATCAGAGCAGG - Intronic
1138387950 16:56648922-56648944 GTGCTGGGCAGAGTCAGAGGAGG + Intronic
1139580614 16:67871719-67871741 GTTGTCAGCAGTATCAAGGGAGG + Exonic
1141309154 16:82896402-82896424 CTTCTCAGGAGGATGAGAGGTGG - Intronic
1142074312 16:88108582-88108604 GTTCTCTGGGGAAACAGAGGTGG - Intronic
1143576906 17:7799044-7799066 GTCCATAGCAGAATCAGCGGGGG - Intronic
1144267629 17:13586389-13586411 TTCCACAGCAGAACCAGAGGGGG + Intronic
1147884500 17:43675647-43675669 GGGCTCAGGAGACTCAGAGGAGG + Intergenic
1149879879 17:60279012-60279034 ATTCAAAGTAGAATCAGAGGAGG + Intronic
1151327092 17:73386169-73386191 GTTCTCAGCAGCAGCAGAAGTGG - Intronic
1153278175 18:3389602-3389624 ATTTTCTGCAGAATCAGAGGAGG + Intergenic
1155563531 18:27107295-27107317 TTTCTCAGCAGTATCAAAAGTGG + Intronic
1156234868 18:35192781-35192803 GTTTTCAGCAAAATCAAAGTGGG - Intergenic
1158374351 18:56846794-56846816 GCTCTCACCAGAAGCAGATGTGG + Intronic
1160235189 18:77080312-77080334 TTTCTCTGCAGAATCAGAACAGG + Intronic
1161152457 19:2716878-2716900 GTTCCCACCAGGACCAGAGGAGG - Exonic
1161604332 19:5206451-5206473 GTGCTCCCCAGAACCAGAGGAGG - Exonic
1162192081 19:8954879-8954901 GGACTCAGCAGAACCAGAGATGG + Exonic
1163547114 19:17947264-17947286 GGTCTCAGAAGAGTCAGAGGTGG - Intergenic
1163614506 19:18318695-18318717 CTCCTCTGCAGAATGAGAGGTGG - Intronic
1167300021 19:48672805-48672827 GCTCCCAGCAGACTCATAGGAGG + Intronic
1168050853 19:53828651-53828673 TTTCTCAGCAGAATCACTAGGGG - Intergenic
925223462 2:2161713-2161735 GCTCCCAGCAGCCTCAGAGGTGG + Intronic
926353396 2:12017751-12017773 CTTCTGAGGAGAATCAGAGTGGG - Intergenic
926644015 2:15269048-15269070 GTTCTCAGCTGAAACAAAAGTGG + Intronic
926786124 2:16520076-16520098 AGTCTCAGCAGAATCACAGGGGG - Intergenic
926818109 2:16821431-16821453 TTTCTCAGCGGCATCAGAGGAGG + Intergenic
928025581 2:27736158-27736180 GTTCTCAGCAGAAGCAGGTTAGG - Intergenic
929878325 2:45815370-45815392 GTTCTCCTCAGAAGCTGAGGGGG + Intronic
930834778 2:55781692-55781714 GTACTCAGCAGCTTCAGTGGCGG - Intergenic
931619432 2:64195014-64195036 GTTCTTGGCAGAATCTGAAGAGG + Intergenic
931673854 2:64673563-64673585 GTTCTCAGTGGGAGCAGAGGTGG + Intronic
931981322 2:67696401-67696423 CTGCTCTGCAGAATCTGAGGAGG + Intergenic
932214675 2:69959023-69959045 GTTCCCAGGAGAATCACAGCTGG + Intergenic
935227378 2:101064749-101064771 GTTCTGAGAACAACCAGAGGTGG + Intronic
936956923 2:118031747-118031769 TTTCTCTGCAGAAACAGAAGAGG + Intergenic
937007244 2:118528321-118528343 GGTCTGAGCAGAAGCAGAGCAGG + Intergenic
937474429 2:122202406-122202428 CTTGTGAGCAGAAGCAGAGGTGG + Intergenic
937926884 2:127174491-127174513 GTCCTCAGCAGCATGAGAGGCGG + Intergenic
938589129 2:132720317-132720339 GTTGTTAGCAGAGTCAGTGGGGG - Intronic
938595809 2:132786043-132786065 GTACTCTGGAGATTCAGAGGAGG + Intronic
938836406 2:135107037-135107059 CTTCTCATCAGAAACAGTGGAGG + Intronic
939070978 2:137542257-137542279 GTTCTCATCAGAAACCGTGGAGG + Intronic
940846222 2:158644789-158644811 GTTCTCTAAAGAAACAGAGGTGG - Intronic
942293551 2:174496227-174496249 CTTCACACCAGAATCACAGGGGG + Intergenic
942983648 2:182112713-182112735 GTTTTCAGCAGAATCTCAGTGGG - Intronic
943109983 2:183592692-183592714 GTTCTCAGCAAAAGAAGAGGGGG - Intergenic
943251501 2:185526355-185526377 GCTGTCAGCAAAATCAGCGGGGG - Intergenic
943500999 2:188689639-188689661 TTTCTCAACAGAATCAGACAAGG - Intergenic
943550951 2:189338965-189338987 ATTCACAACAGAATCAAAGGAGG - Intergenic
943703090 2:191007139-191007161 GCGCTCAGTAGAATCAGTGGAGG - Intronic
944146793 2:196514769-196514791 GCTCTCAGGAGACTCAGAGTGGG - Intronic
944830865 2:203533554-203533576 GATTTCAGCAGATTCAGATGGGG - Intronic
945408726 2:209484104-209484126 GTTCTTAGAAGAAATAGAGGAGG - Intronic
946208248 2:218126421-218126443 GTTCTCAGGGGCCTCAGAGGAGG - Intronic
947084613 2:226437015-226437037 GCTCTCTGCAGAATCAGATTAGG - Intergenic
948108984 2:235439378-235439400 TTTCTCAGCAGCAGTAGAGGTGG - Intergenic
948789369 2:240369449-240369471 GCTCTCTGCAGAACCAGATGTGG - Intergenic
1168807365 20:679903-679925 GTTCGCTGCAGCATCAGAGATGG + Intergenic
1170500298 20:16968861-16968883 GTTATCAGCAGAATAAGAAGAGG - Intergenic
1170682949 20:18543106-18543128 GTTCCGAGCGGAGTCAGAGGAGG + Exonic
1170914401 20:20608798-20608820 GTTGTCATGAGAATCAGAGTGGG - Intronic
1171286898 20:23947346-23947368 CTTCTCAGAAGACACAGAGGAGG - Intergenic
1174226015 20:49000865-49000887 CTTCACAACAGAATCACAGGTGG - Intronic
1175430185 20:58896177-58896199 ATTCTCACCAGAAACAGATGTGG + Intronic
1177047206 21:16185199-16185221 GGTCTGGGCAGAAGCAGAGGAGG + Intergenic
1179062306 21:37990233-37990255 GTTCTCAGTGGCCTCAGAGGAGG + Intronic
1179253673 21:39696873-39696895 GTTCTTACCAGAATCTCAGGAGG + Intergenic
1179943763 21:44656506-44656528 CTTCTCAGCAAAAACAGTGGAGG - Intronic
1181464919 22:23105835-23105857 GTTCTCAGCTGAAACAGAAGTGG + Intronic
1182574903 22:31266512-31266534 GTTCTCAGCAGAAGAGGAGGAGG - Intronic
1183402677 22:37613875-37613897 GTTCTCAGCAGAATCAGAGGAGG + Intronic
1184364678 22:44042561-44042583 GTTCTCAGCAGCAGCAGTGCAGG - Intronic
950669907 3:14519746-14519768 ACTCTCAGCAGATCCAGAGGAGG - Intronic
953759094 3:45672868-45672890 GATCTCAGCAGAGTGAGTGGTGG + Intronic
954030971 3:47819722-47819744 GTACTCAGCAGAATCAGATTTGG + Intronic
954571658 3:51646000-51646022 CTTCTTAGCAGAAAGAGAGGGGG + Intronic
961064126 3:123860160-123860182 GCTGTCTGCAGAATCAAAGGAGG - Intronic
961288973 3:125829911-125829933 GGTCTCAGAAGAATAAGATGTGG - Intergenic
963051857 3:141149785-141149807 ATTCTCAGAAGAAGCAGAGATGG - Intergenic
963693176 3:148531143-148531165 GTTCTCAGCAGATGCAGGAGAGG + Intergenic
966700934 3:182850056-182850078 GTTCTCATCAGAAACAACGGAGG + Intronic
967117652 3:186356253-186356275 GTGCTCATCAGATTCAGAGATGG + Intronic
967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG + Intergenic
968510455 4:993257-993279 GATCTCAGCTGCAGCAGAGGGGG - Intronic
969061622 4:4439860-4439882 CTTCACAGAAGAGTCAGAGGTGG - Intronic
970908826 4:21250145-21250167 GTTCTCTGCAAAACCACAGGTGG + Intronic
971674706 4:29611505-29611527 GTTCTCACCAGATTAAGAGTGGG - Intergenic
972646026 4:40968156-40968178 TTTTACAGCAGAAACAGAGGAGG + Intronic
973951566 4:56020136-56020158 GTTCTCGGGAGAAGAAGAGGTGG + Intronic
976043823 4:80920459-80920481 GACCTAAGGAGAATCAGAGGTGG - Intronic
976868709 4:89764019-89764041 GTTGTCTGCAGAAACAGATGGGG + Intronic
977501479 4:97844512-97844534 CTTCTCATCAGAATCAGTGGAGG - Intronic
977960091 4:103075973-103075995 GTTCTCAGATTAACCAGAGGGGG - Intronic
978848898 4:113309472-113309494 GAACTCAGCGTAATCAGAGGTGG + Intronic
981541148 4:145847392-145847414 GTTGTCATCAAAGTCAGAGGCGG - Intronic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
984143305 4:176030443-176030465 GTTCTCTTCAGGAACAGAGGAGG + Intergenic
985861623 5:2476025-2476047 AAACTCAGCAGAAGCAGAGGGGG + Intergenic
986088752 5:4480730-4480752 GTTGTCAACACAATCACAGGAGG + Intergenic
987667013 5:20956221-20956243 GTTTTCATCAGAATTGGAGGGGG - Intergenic
987864091 5:23518851-23518873 GTTCTGAGAAGAATCAGATATGG - Intronic
988635249 5:32976831-32976853 GCCCTCACCAGAAGCAGAGGCGG + Intergenic
988696309 5:33625983-33626005 GCCTTCAGCAGAATCAGAGGTGG + Intronic
990396296 5:55383505-55383527 CTTCTCAGCAGAAACAATGGAGG - Intronic
998222269 5:140294226-140294248 GCTCTCAGCAGAATCAAATTTGG - Intronic
1000556450 5:162732393-162732415 ACTCTCAGCAAAATGAGAGGAGG + Intergenic
1001917283 5:175572215-175572237 GCTCTCACCAGAAATAGAGGAGG + Intergenic
1003476104 6:6484842-6484864 GTTCTCAGCAGCAGCATAGAAGG - Intergenic
1006817298 6:36860634-36860656 GCTCTCAGGAGAATGAGTGGTGG - Intronic
1010870582 6:81032449-81032471 GTGCCCAGCAAAGTCAGAGGTGG - Intergenic
1011004772 6:82631937-82631959 GGACTCAGCAGAATCTTAGGTGG + Intergenic
1011135001 6:84090492-84090514 CTTGTCAGCTGAATGAGAGGAGG + Exonic
1011556145 6:88573161-88573183 GTTCTCAGAAGGGTCAGAAGTGG + Intergenic
1012394314 6:98778361-98778383 GATCCCAGAAGAAGCAGAGGTGG + Intergenic
1012763164 6:103329722-103329744 TTTCTCTGAAGAATCTGAGGAGG + Intergenic
1012769035 6:103405269-103405291 GCTCTCAGCAGAAGGAGAGCTGG + Intergenic
1013597054 6:111669847-111669869 TTTCTCAGCAGCTTCAGAGAAGG - Intronic
1014144429 6:117981012-117981034 GTATGCAGCAGAAGCAGAGGTGG + Intronic
1016351444 6:143173378-143173400 GATCTCAGCAGAATTAAATGAGG - Intronic
1016383220 6:143506679-143506701 GTTTCCAGAAAAATCAGAGGTGG - Intronic
1016631593 6:146239761-146239783 GTTCTCATCAGAATCACACCTGG + Intronic
1017738854 6:157386981-157387003 GTTTTCAGCAGCATCATATGAGG + Intronic
1018066776 6:160130233-160130255 GTTCTCATGACATTCAGAGGAGG - Intronic
1018606956 6:165607913-165607935 GTTCTCTGCAAACTCAGCGGAGG - Intronic
1019056761 6:169229288-169229310 CTCCTCAGCAGAAGGAGAGGAGG + Intronic
1019079824 6:169422713-169422735 GTGCTCAGTAAACTCAGAGGGGG + Intergenic
1019304817 7:328264-328286 GTCTTCAACAGAAACAGAGGCGG - Intergenic
1020916139 7:14195428-14195450 GTTCTTAGGAGAATAAGAGTGGG - Intronic
1025255747 7:57382961-57382983 GTGCTGAGAAGAATCAGACGTGG - Intergenic
1026410708 7:70118912-70118934 GTTCTCAGAAGTAATAGAGGGGG - Intronic
1026672158 7:72400015-72400037 GTCCTCAGCAGAAGCAGATTAGG + Intronic
1028726525 7:94093877-94093899 ATTCTCAAAAGAATCTGAGGTGG - Intergenic
1029379013 7:100200452-100200474 GTTCTCAGCTGATGCAGAGAAGG + Exonic
1029798119 7:102916583-102916605 GTTGACAGCAAAATCACAGGTGG + Intronic
1030278462 7:107744398-107744420 GAGCTCAGCAGAACCAGAGTAGG - Intronic
1033769212 7:144529779-144529801 GCTCTCAGCAGAATCACAAAAGG + Intronic
1035598019 8:876471-876493 CTTCTCAGCAGAAACAGTAGAGG - Intergenic
1036911089 8:12757417-12757439 TTTCACATCAGAATCAGATGTGG - Intergenic
1036912366 8:12767835-12767857 CCCCTCAGCATAATCAGAGGAGG - Intergenic
1037233749 8:16691468-16691490 ATTCTCAGCAGAATGTGAGCGGG - Intergenic
1039429615 8:37515635-37515657 TTTCTCAGCATAATCAGGAGGGG - Intergenic
1040857002 8:51958712-51958734 GTCCACAGCAGAATGAAAGGAGG - Intergenic
1042705578 8:71663020-71663042 GATCTGAGCAGTATAAGAGGAGG + Intergenic
1047362280 8:124179975-124179997 ATTCACAGCTCAATCAGAGGAGG - Intergenic
1048316141 8:133363830-133363852 CTTTTCAGCAGAATCACTGGAGG + Intergenic
1048870852 8:138796613-138796635 GTACTCAGCAGAAAGAGAGAAGG - Intronic
1051350381 9:16193113-16193135 CTGTTGAGCAGAATCAGAGGTGG + Intergenic
1052154901 9:25173548-25173570 CTTCTCAACAGAAACAGTGGAGG - Intergenic
1052359457 9:27538513-27538535 GTTCTCAAGAGAAACAGAGTGGG - Intergenic
1053274089 9:36770478-36770500 CTTCTCTGAAGAATCAGGGGTGG - Intergenic
1054801906 9:69358240-69358262 GTTCCCAGCAGAAGCAATGGTGG + Intronic
1056156526 9:83844049-83844071 GTTCTCACCAGATTAAGAGTGGG - Intronic
1057005916 9:91558974-91558996 ATTCCCATCAGAAACAGAGGAGG + Intergenic
1059390317 9:113995698-113995720 GCTCTCAACAAAATTAGAGGAGG - Intronic
1060702781 9:125773370-125773392 GTTATCAGCAGACTCAGAGGTGG - Intronic
1060798632 9:126529356-126529378 GTTGACACCAGAATCAGAGCGGG - Intergenic
1061318491 9:129813002-129813024 GTTCTCAGCATCCTCAGAAGGGG + Exonic
1061409112 9:130409019-130409041 GTACACTGCAGAAGCAGAGGGGG - Intronic
1062171304 9:135136338-135136360 TTTTTCCGCAGAAACAGAGGTGG - Intergenic
1062184771 9:135212077-135212099 GCTCTCAGCAGAGAGAGAGGAGG - Intergenic
1062452940 9:136623137-136623159 GAGCCCAGCAGCATCAGAGGCGG - Intergenic
1185674807 X:1840598-1840620 GTTTTCATCAGAAGCAGATGTGG + Intergenic
1186566309 X:10666630-10666652 GTTCTGAGCACAATTAAAGGGGG + Intronic
1186569360 X:10697945-10697967 GTTCTCAACAGAGTGAGAGTGGG - Intronic
1186810866 X:13187264-13187286 TCTATCAGCAGAAGCAGAGGAGG + Intergenic
1187485672 X:19700902-19700924 GTTCTCAGAAGAGTGAGGGGAGG - Intronic
1188985475 X:36764932-36764954 GTACTCAGCAGAAACAAAGGTGG - Intergenic
1189023097 X:37362826-37362848 GTCCTCAGCAGACTGGGAGGGGG + Intronic
1189572549 X:42314069-42314091 ATTCTCAGCAGAATCCAAGAAGG - Intergenic
1189981732 X:46517637-46517659 ATTCTCATCAGAAACAGTGGAGG + Intronic
1191865249 X:65698573-65698595 GTCCCCAGCAGAAGCAGTGGGGG - Intronic
1192226892 X:69235119-69235141 GCTTCCAGGAGAATCAGAGGAGG - Intergenic
1194880226 X:99241994-99242016 GTTCTCAGCATAGGGAGAGGGGG - Intergenic
1199279182 X:145979978-145980000 CTTCTCATCAGAAGCAAAGGAGG + Intergenic
1199726253 X:150585321-150585343 CTTCTGAGCAGAATCAGTAGTGG - Intronic
1199789305 X:151137148-151137170 GTTCTAAGCAGAATCAGGCCTGG - Intergenic
1200682310 Y:6226835-6226857 GTGCTTGGCAGAATCAGAGTGGG + Intergenic
1201865914 Y:18654190-18654212 GTTCTCATCAGTATCACAGATGG + Intergenic