ID: 1183405694

View in Genome Browser
Species Human (GRCh38)
Location 22:37629618-37629640
Sequence GGGCTCTACTCAAGAGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183405685_1183405694 29 Left 1183405685 22:37629566-37629588 CCAGGGTCAGGGCAGCTGGGACA 0: 1
1: 0
2: 1
3: 58
4: 478
Right 1183405694 22:37629618-37629640 GGGCTCTACTCAAGAGCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 119
1183405684_1183405694 30 Left 1183405684 22:37629565-37629587 CCCAGGGTCAGGGCAGCTGGGAC 0: 1
1: 0
2: 3
3: 41
4: 366
Right 1183405694 22:37629618-37629640 GGGCTCTACTCAAGAGCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 119
1183405690_1183405694 1 Left 1183405690 22:37629594-37629616 CCTGGAGAAACTAAAAGGATGGA 0: 1
1: 0
2: 0
3: 20
4: 293
Right 1183405694 22:37629618-37629640 GGGCTCTACTCAAGAGCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183405694 Original CRISPR GGGCTCTACTCAAGAGCCCA GGG Intronic
900474334 1:2869200-2869222 GGGCTCTTGTCCTGAGCCCAAGG + Intergenic
902739617 1:18426895-18426917 GGGGTCTACACAAGTGGCCATGG + Intergenic
904593573 1:31628804-31628826 AGGGACTGCTCAAGAGCCCAGGG + Intronic
905100123 1:35512933-35512955 GGGCTATACACTATAGCCCAGGG + Intronic
905110869 1:35593530-35593552 AGGCTTTCCTCAAGTGCCCAAGG + Intronic
912433022 1:109639569-109639591 GGGCTCTGCTCAAGTGCACATGG - Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
924207958 1:241733705-241733727 GGCTTCTACTAAAGAGGCCAGGG - Intronic
1063058312 10:2525811-2525833 AGGCTCTTCTCAAGACCCCGGGG + Intergenic
1063917975 10:10903808-10903830 GGGCACTATAGAAGAGCCCAAGG - Intergenic
1065440077 10:25744007-25744029 AAGCTCTACTCAAGATTCCATGG + Intergenic
1067220615 10:44341439-44341461 GGGCTCCACCAAAGAGCCTAGGG + Intergenic
1067667095 10:48288022-48288044 GGGCTTTACTTAACAGCCCCAGG + Intergenic
1071201604 10:83225313-83225335 AGGCACTACTAAAGAGCTCAAGG - Intergenic
1077369477 11:2174742-2174764 AGGCTCCACTCCAGCGCCCACGG + Intergenic
1078899137 11:15625210-15625232 GGGCTCTTATCAATAGCTCACGG + Intergenic
1079209639 11:18449767-18449789 GGGCTCTACTCAGGAGCACAAGG - Intronic
1079381511 11:19942301-19942323 GGGCTCTACATCAGATCCCAAGG - Intronic
1079694082 11:23456828-23456850 AGGCTCTACTCAAGAGAAGATGG - Intergenic
1083304841 11:61756819-61756841 TGGCTCTACTTAAGACCCCAAGG - Intronic
1083586361 11:63862598-63862620 GGGCTCTACGCAAGAGCTATGGG + Intronic
1084173014 11:67409661-67409683 GGGCCCGAGTCAGGAGCCCATGG - Exonic
1084536620 11:69761157-69761179 GGCCTCTGCTCAAGAGCCACTGG + Intergenic
1085952102 11:81344495-81344517 GTGCTCTAGTCAACAGCTCATGG - Intergenic
1086120002 11:83295697-83295719 GGGCTCTTCCCCAGAGCCTAAGG - Intergenic
1086624331 11:88928040-88928062 AGGGTCTACTCATGAGCCCCTGG - Intronic
1090403861 11:126465834-126465856 GAGGTCTGCTGAAGAGCCCAAGG - Intronic
1090970298 11:131636642-131636664 GTGCGCTGCTCCAGAGCCCACGG + Intronic
1095977521 12:47949900-47949922 AGGCTCTTCTCAAGGCCCCAAGG + Intergenic
1096545866 12:52339926-52339948 GAGCTCTACTCAAGGGCCTGGGG + Intergenic
1101817452 12:108156491-108156513 AGGCTCTGCTCAACAACCCAAGG - Intronic
1111647540 13:91049589-91049611 GGGCTTTGCTGAAGTGCCCAGGG - Intergenic
1112143573 13:96673039-96673061 GGGTTCTCCTCTAGAGCCCCTGG - Intronic
1118462640 14:66000904-66000926 GAGATCTACACAAGTGCCCAAGG + Intronic
1118777885 14:68985052-68985074 GAGCTCTTCCTAAGAGCCCAGGG + Intergenic
1119781158 14:77277688-77277710 GGGCTCTTCCCAAGAGGCCCAGG + Intronic
1122146044 14:99689414-99689436 GTGCTCTACACAAGTCCCCAGGG - Intronic
1122871486 14:104640916-104640938 GGGGTCAACTCAGGAGCCAATGG - Intergenic
1125423669 15:39529110-39529132 GGGCTCTGCACAGGAACCCAGGG + Intergenic
1125732236 15:41899584-41899606 GATCTCTTCTCAACAGCCCAGGG + Exonic
1127629739 15:60815688-60815710 GGACTCTAATGAAGAGCCAAGGG - Intronic
1133050390 16:3114187-3114209 GGGCTCTACTGACATGCCCAAGG - Intronic
1133278340 16:4651409-4651431 AGGCTCTACTGGAGAGGCCATGG + Intronic
1135167782 16:20156066-20156088 AGGATCTACTCAAGGACCCATGG - Intergenic
1141562250 16:84877313-84877335 CAGCTCTATTCAAGGGCCCAGGG + Intronic
1144161631 17:12566126-12566148 TGGCTGGACTCAAGAGCCTAAGG + Intergenic
1145415355 17:22710030-22710052 TGGCTGTACTCAAGGGCTCAGGG + Intergenic
1147500625 17:40960047-40960069 GAGCTGTTCTGAAGAGCCCATGG - Intronic
1148152523 17:45405020-45405042 GGGCTCACCGAAAGAGCCCACGG + Exonic
1152267707 17:79305903-79305925 GGGCTCTACGCTAGAGGCTACGG - Intronic
1155024547 18:21929367-21929389 GGTCTGTACTGAAGAGTCCAGGG + Intergenic
1155651992 18:28153568-28153590 CTGCTCTTCTTAAGAGCCCAGGG - Intronic
1156913107 18:42434677-42434699 GGGCTCAGCTTATGAGCCCAGGG + Intergenic
1157283735 18:46362944-46362966 GGACTCCACACAAGAGCCCCGGG - Intronic
1160037745 18:75317139-75317161 GGGCCCCACTCCAGAGACCATGG - Intergenic
1163129737 19:15265049-15265071 GGCCTCTCCCCAAGTGCCCAGGG + Intronic
1163748773 19:19063455-19063477 GGGCTCTACACGAGAGCCTCAGG + Intergenic
1165110498 19:33499443-33499465 GGGCTGACCTCAACAGCCCAGGG - Intronic
1166141158 19:40806133-40806155 GGGCTCCACTCCACAGCCAAGGG + Intronic
1166519982 19:43473858-43473880 GGGCTATAATGAAAAGCCCAGGG + Intergenic
927454031 2:23233860-23233882 AGGCTCTTCTCTAGAACCCAGGG - Intergenic
930630843 2:53753427-53753449 GGACTCTACTCCAGAACACATGG - Intronic
934852291 2:97708976-97708998 GGGCTCAACTGATGACCCCAAGG - Intergenic
936976120 2:118224256-118224278 CGGCTCTGCTCAGGCGCCCACGG - Intergenic
937110855 2:119366526-119366548 GGGGTCTCCTCTAGACCCCAAGG + Exonic
945019675 2:205558178-205558200 TGGCTCTAGGCAAGAGGCCAGGG + Intronic
946008169 2:216543109-216543131 GGGGTCTGCTGAAGAGCCTATGG + Intronic
949063808 2:241976957-241976979 GGGCTCTACCAAGGAGCACAAGG - Intergenic
1173248934 20:41354435-41354457 GAGCTATACTCAAAAGACCAAGG - Intronic
1176051997 20:63124781-63124803 GGGCCGGACTCCAGAGCCCAAGG + Intergenic
1177863524 21:26484195-26484217 GGGGACTACACAAAAGCCCAAGG + Intronic
1179224379 21:39440706-39440728 GTGATCTTCTCAAGTGCCCATGG - Intronic
1181014376 22:20060845-20060867 AGGCTCTTCTCTAGAGGCCAGGG - Intronic
1181106491 22:20578874-20578896 GGGCTCTTCTCCAGAGGGCAGGG + Intronic
1183405694 22:37629618-37629640 GGGCTCTACTCAAGAGCCCAGGG + Intronic
952566150 3:34661013-34661035 GGGCTCCAGTGAAGGGCCCATGG + Intergenic
955413353 3:58670195-58670217 CTGCTCTACTCACCAGCCCATGG + Intergenic
961683099 3:128611953-128611975 CAGCTCTACCCGAGAGCCCAGGG - Intergenic
967464996 3:189794750-189794772 GAGCTCTACTAGAGAGCACAGGG + Intronic
967489271 3:190070546-190070568 GTGCTGTAATCAAGAGCACACGG + Intronic
968456609 4:703762-703784 GAGCTGGACACAAGAGCCCAGGG + Intergenic
968763536 4:2455999-2456021 GGGCACTGCTCAAGAGCCTTTGG + Intronic
969289446 4:6229352-6229374 GGGCTCTACTCAGCATCCCAAGG + Intergenic
969711891 4:8849474-8849496 GGGCTCTCCTCTAGAGCCTCTGG + Intronic
976343532 4:83972738-83972760 GGGCTTAGCTCCAGAGCCCAGGG + Intergenic
979511192 4:121555844-121555866 GGTCTCAACTCCAGAGGCCAGGG + Intergenic
981011330 4:139928329-139928351 GAGTTCTACTCCAGAGCCCACGG - Intronic
984199878 4:176705282-176705304 AGTCTCTACTAAAGGGCCCATGG + Intronic
997864341 5:137447859-137447881 CGGCTATATTCAAAAGCCCAGGG + Intronic
999340692 5:150768323-150768345 AGGCTCTACTCTAGGGCCTAGGG + Intergenic
1001101738 5:168819911-168819933 GGGCTCTCGTCAAAAGCCCAGGG + Intronic
1005599997 6:27416957-27416979 GCACTCTACTCAAGAGTCAAGGG - Intergenic
1005918824 6:30380216-30380238 GGGAACTCCTCAAGACCCCAAGG + Intergenic
1006574128 6:35031509-35031531 GGGTTCTGGTCAAGAGCACAAGG - Intronic
1007376994 6:41463724-41463746 GAGTTCTACTAAATAGCCCAAGG - Intergenic
1009236242 6:61127649-61127671 CAGCTATACTCAAGAGTCCACGG + Intergenic
1010128609 6:72464973-72464995 TGGCTCTACTTAAAAGCACATGG + Intergenic
1018279985 6:162175010-162175032 AGGCTCTACTAAAGAGACAAGGG + Intronic
1019575600 7:1736125-1736147 GGGCTCTGCGGCAGAGCCCAGGG + Intronic
1021761802 7:23909648-23909670 CCACTCTACTCAAAAGCCCAGGG + Intergenic
1022509007 7:30923401-30923423 GGGCTCCACTCAAAAGCCCCTGG - Intronic
1022811956 7:33878329-33878351 AGACTCTAATCAAGAGTCCACGG + Intergenic
1024254668 7:47531847-47531869 TGGCCCCACTCAAGAGCGCAGGG - Intronic
1025254592 7:57375010-57375032 TGCCTCTACTCAGGAGCTCAGGG + Intergenic
1026639476 7:72111571-72111593 GGTGTGTACTCAAGAGGCCAAGG - Intronic
1027245915 7:76367289-76367311 GGGCTCTTCTCTAGAGAACATGG - Intergenic
1027261268 7:76466123-76466145 GGGCTCTTCTCTCTAGCCCATGG - Intronic
1027312652 7:76964231-76964253 GGGCTCTTCTCTCTAGCCCATGG - Intergenic
1028969289 7:96839479-96839501 TGGGAGTACTCAAGAGCCCATGG + Intergenic
1031846247 7:126808654-126808676 GTTTTTTACTCAAGAGCCCAAGG - Intronic
1034414534 7:150957610-150957632 GGGGTCAGCTCAAGAGACCAGGG + Intronic
1036786272 8:11689777-11689799 AGGCTCTGCCCGAGAGCCCAGGG + Intronic
1038227242 8:25668790-25668812 TGCCTCTACCCAGGAGCCCAGGG + Intergenic
1043496780 8:80810005-80810027 GGGCTGTGTTCAAGAGGCCATGG - Intronic
1044883396 8:96747602-96747624 GGGCACTACTTAGGAGCCAAAGG + Intronic
1045017318 8:98010709-98010731 GGGCTGGACTCAGGAGTCCAAGG + Intronic
1048109736 8:131454456-131454478 GGGCTCAACTCAACACTCCAGGG - Intergenic
1048207214 8:132424712-132424734 GGGCTCTCCTCTAGAGCCTTCGG - Intronic
1049255351 8:141610760-141610782 GGGCTCTGCTCAGGGTCCCATGG - Intergenic
1056132868 9:83602825-83602847 GGGCAGTGCTCTAGAGCCCAAGG - Intergenic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1185457943 X:319845-319867 GGGCTGGACTCAAGCCCCCAAGG - Intergenic
1185457984 X:319970-319992 GGGCTGGACTCAAGCCCCCAAGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192806066 X:74510479-74510501 GGGCTCTACTTAATGGCCTATGG - Intronic
1194473727 X:94333096-94333118 GGGCTCTTCTCTAAAGCCTAAGG + Intergenic
1199787333 X:151117081-151117103 GGGCTCTTCCCAAATGCCCATGG - Intergenic
1201073233 Y:10168961-10168983 GGCCTCTGCTCCAGAACCCATGG + Intergenic