ID: 1183407895

View in Genome Browser
Species Human (GRCh38)
Location 22:37639494-37639516
Sequence CCCCGCTGCTGTGTGTCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 177}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183407895_1183407907 1 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407907 22:37639518-37639540 CCCGGCCGGGGGTCGCCCGGGGG 0: 1
1: 0
2: 1
3: 20
4: 162
1183407895_1183407902 -10 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407902 22:37639507-37639529 AGCAGCGGGGGCCCGGCCGGGGG 0: 1
1: 0
2: 6
3: 39
4: 395
1183407895_1183407918 25 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407918 22:37639542-37639564 CCGGAAGCCGGGGAAGAGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 178
1183407895_1183407913 15 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407913 22:37639532-37639554 GCCCGGGGGCCCGGAAGCCGGGG 0: 1
1: 1
2: 1
3: 29
4: 307
1183407895_1183407912 14 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407912 22:37639531-37639553 CGCCCGGGGGCCCGGAAGCCGGG 0: 1
1: 0
2: 1
3: 24
4: 264
1183407895_1183407911 13 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407911 22:37639530-37639552 TCGCCCGGGGGCCCGGAAGCCGG 0: 1
1: 0
2: 1
3: 5
4: 132
1183407895_1183407905 0 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407905 22:37639517-37639539 GCCCGGCCGGGGGTCGCCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 226
1183407895_1183407910 6 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407910 22:37639523-37639545 CCGGGGGTCGCCCGGGGGCCCGG 0: 1
1: 0
2: 3
3: 38
4: 318
1183407895_1183407903 -2 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407903 22:37639515-37639537 GGGCCCGGCCGGGGGTCGCCCGG 0: 1
1: 0
2: 5
3: 44
4: 391
1183407895_1183407904 -1 Left 1183407895 22:37639494-37639516 CCGGCGGACACACAGCAGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1183407904 22:37639516-37639538 GGCCCGGCCGGGGGTCGCCCGGG 0: 1
1: 0
2: 2
3: 38
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183407895 Original CRISPR CCCCGCTGCTGTGTGTCCGC CGG (reversed) Exonic