ID: 1183409551

View in Genome Browser
Species Human (GRCh38)
Location 22:37646913-37646935
Sequence AGGCACCTGCCACAGCGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 244}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183409551_1183409573 17 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409573 22:37646953-37646975 GCAGGAGGTTGGGGGGGAGGGGG 0: 1
1: 2
2: 23
3: 277
4: 3156
1183409551_1183409568 11 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409568 22:37646947-37646969 CCCTGGGCAGGAGGTTGGGGGGG 0: 1
1: 1
2: 7
3: 98
4: 862
1183409551_1183409556 -6 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409556 22:37646930-37646952 GTGCCTGATCCGGGGAGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 160
1183409551_1183409559 -1 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409559 22:37646935-37646957 TGATCCGGGGAGCCCTGGGCAGG 0: 1
1: 0
2: 1
3: 35
4: 248
1183409551_1183409570 14 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409570 22:37646950-37646972 TGGGCAGGAGGTTGGGGGGGAGG 0: 1
1: 1
2: 30
3: 232
4: 1978
1183409551_1183409565 9 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409565 22:37646945-37646967 AGCCCTGGGCAGGAGGTTGGGGG 0: 1
1: 0
2: 8
3: 71
4: 639
1183409551_1183409560 2 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409560 22:37646938-37646960 TCCGGGGAGCCCTGGGCAGGAGG 0: 1
1: 0
2: 5
3: 56
4: 615
1183409551_1183409571 15 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409571 22:37646951-37646973 GGGCAGGAGGTTGGGGGGGAGGG 0: 1
1: 0
2: 17
3: 225
4: 2821
1183409551_1183409572 16 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409572 22:37646952-37646974 GGCAGGAGGTTGGGGGGGAGGGG 0: 1
1: 0
2: 16
3: 224
4: 2295
1183409551_1183409574 25 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409574 22:37646961-37646983 TTGGGGGGGAGGGGGTGCAGTGG 0: 1
1: 0
2: 17
3: 208
4: 1629
1183409551_1183409557 -5 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409557 22:37646931-37646953 TGCCTGATCCGGGGAGCCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 226
1183409551_1183409566 10 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409566 22:37646946-37646968 GCCCTGGGCAGGAGGTTGGGGGG 0: 1
1: 0
2: 8
3: 85
4: 727
1183409551_1183409564 8 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409564 22:37646944-37646966 GAGCCCTGGGCAGGAGGTTGGGG 0: 1
1: 0
2: 7
3: 72
4: 659
1183409551_1183409562 6 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409562 22:37646942-37646964 GGGAGCCCTGGGCAGGAGGTTGG 0: 1
1: 3
2: 11
3: 148
4: 1347
1183409551_1183409563 7 Left 1183409551 22:37646913-37646935 CCCGCACGCTGTGGCAGGTGCCT 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1183409563 22:37646943-37646965 GGAGCCCTGGGCAGGAGGTTGGG 0: 1
1: 0
2: 5
3: 54
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183409551 Original CRISPR AGGCACCTGCCACAGCGTGC GGG (reversed) Exonic
900609892 1:3540086-3540108 AGGAAACTGCCCCAGCGTCCTGG + Intronic
901215529 1:7552785-7552807 AGGCCCCTGCCACAGCTCCCGGG + Intronic
901870806 1:12138300-12138322 GGAGACCTGCCACAGCGTGGGGG + Exonic
904092689 1:27956240-27956262 AGGCACCTGCCACCGAGTCAGGG + Intronic
904772366 1:32887226-32887248 ATGCACCCGTCACAGCGTGAGGG - Intronic
905313016 1:37063657-37063679 AGCCACCAGCCACAGAGTGATGG + Intergenic
906426650 1:45719867-45719889 AGGCGCCTGCCACCGCGCCCAGG + Intronic
908432013 1:64067854-64067876 AGGCGCCTGCCACCGCGCCCGGG + Intronic
911861270 1:102952240-102952262 AGGCACCCGCCACCACGTCCAGG + Intronic
915440500 1:155942657-155942679 AGGTGCCTGCCAGAGCCTGCCGG - Exonic
917853997 1:179087246-179087268 AGGAACCCTCCACAGCTTGCAGG + Intronic
918779139 1:188673457-188673479 AGGCACCTGCCACTGCACCCAGG - Intergenic
920310096 1:205043683-205043705 AGGCAGCTGCCACTGCCCGCTGG - Intronic
920545983 1:206818954-206818976 AGGCACCTGCCACAGCGCCCAGG + Intronic
921202910 1:212824163-212824185 AAGCACCTGCCTCACAGTGCAGG + Intergenic
922125406 1:222716240-222716262 AGGCACCTGCCACCACGCCCTGG + Intronic
924444445 1:244116322-244116344 AGGCACCTGCCACCACGTCTAGG + Intergenic
1062822494 10:545308-545330 AGGCACCTGCCACAACGCCCAGG + Intronic
1063920923 10:10932034-10932056 AGGCCCCTCCCACAGTGTGTGGG + Intergenic
1063934352 10:11061954-11061976 AGGCACCTGCCACCACGCCCAGG + Intronic
1064324216 10:14333583-14333605 AGGCTCCTGCCTCAGTGTGTGGG + Intronic
1073056914 10:100709196-100709218 AGGCAGTGGCCACAGTGTGCTGG + Intergenic
1073177226 10:101564012-101564034 AGGCATGAGCCACTGCGTGCAGG - Intergenic
1074050343 10:109876014-109876036 AGGCCCCTGCCTCAGCCTCCAGG + Intronic
1075583826 10:123643137-123643159 AGGCACTTGCCACAGACTCCTGG + Intergenic
1075675191 10:124291360-124291382 AGGCACATGCCACAAAGTGAAGG + Intergenic
1076407104 10:130219879-130219901 AGGCACCTGCCACCACGCCCAGG + Intergenic
1076999397 11:315162-315184 GGGCAACAGCCCCAGCGTGCAGG - Exonic
1077042338 11:530305-530327 TGGCTCCTTCCACACCGTGCTGG - Intergenic
1077113748 11:873451-873473 AGGCACCAGCCACAGTGAGTGGG + Intronic
1077526503 11:3068960-3068982 AGGCACCCGCCACCACGTCCGGG - Intergenic
1079382439 11:19949662-19949684 AGGAGCCTGCCACAGAGTGGTGG - Intronic
1080497586 11:32835053-32835075 ATCCACCTGCCTCAGCCTGCTGG + Intronic
1082270466 11:50164396-50164418 AGGCAGCTCCCTCAGCTTGCAGG - Intergenic
1082718054 11:56639823-56639845 AGGCACCTGCCACCATGCGCAGG + Intergenic
1083203745 11:61135064-61135086 CGGCACCCGCCACAGGGCGCAGG + Intronic
1083436885 11:62648870-62648892 AGGCACCTGCCCCAGAGGCCTGG + Exonic
1083845031 11:65326661-65326683 AGGCACCAGCCACAGGGCCCTGG + Intergenic
1083864893 11:65448419-65448441 AGGCACCAGCCACAGGGCCCTGG + Intergenic
1084240739 11:67818011-67818033 AGGCATCTCCCTCAGCTTGCGGG - Intergenic
1084592427 11:70098381-70098403 AGGCACCTCCCATATCGGGCAGG - Intronic
1084637607 11:70402636-70402658 TGACACCTGCTACAGCGTGGAGG - Intronic
1084734213 11:71094033-71094055 ACGGACCCGCCACAGGGTGCTGG + Intronic
1084802660 11:71555200-71555222 TGGCCCCTTCCACACCGTGCTGG - Intronic
1087710296 11:101541503-101541525 AGGCACCTGCCACCACGCCCGGG + Intronic
1089245376 11:117115613-117115635 AGGCACCTGCCACCACGCCCGGG - Intergenic
1092352156 12:7764330-7764352 AGGCACCTGCCACCACGCCCGGG - Intergenic
1094548022 12:31423082-31423104 AGGCACCTGCCACCACGCCCAGG + Intronic
1095476523 12:42591464-42591486 AGGCACCTGCCACCGCGCCCAGG + Intergenic
1095558661 12:43539094-43539116 AGGCACCTGCCACCGCGCCCAGG + Intronic
1097333699 12:58359118-58359140 AGGTAGCTGCCGCAGCCTGCAGG + Intergenic
1098922380 12:76314336-76314358 AGGCACCTGCCACCACGCCCTGG - Intergenic
1100121807 12:91377073-91377095 AGGCACCAACCACAGGGTGATGG + Intergenic
1100797268 12:98195933-98195955 AGGCACCTGCCACCACGCCCAGG + Intergenic
1100959140 12:99943695-99943717 AGGTCCCTGCCACAACATGCGGG + Intronic
1101128737 12:101666511-101666533 AGGCACCTGCCACAGAGAAGAGG - Intronic
1104477587 12:129083375-129083397 AGGCAGCTGTGACAGCGTGTGGG + Intronic
1104729065 12:131095027-131095049 AGGCACAGGCCACAGGGTACAGG - Intronic
1105517456 13:21103400-21103422 AGGCACCTGCCACCACGCCCAGG - Intergenic
1105889085 13:24669184-24669206 AGGCACCACCCAGAGCTTGCAGG + Intergenic
1106310884 13:28553288-28553310 AGGCGCCTGCCACCGCGTCTGGG - Intergenic
1107099977 13:36579781-36579803 AGGCACCTGCCACCACGCCCAGG + Intergenic
1108581544 13:51832499-51832521 AGGCAACTGGCAAAGAGTGCAGG + Intergenic
1109201820 13:59439876-59439898 AGCCACCTCCCTCAGCTTGCTGG + Intergenic
1112709358 13:102109761-102109783 AGGCACCTGCCACAACGCCCAGG + Intronic
1113821587 13:113218092-113218114 AGGCACCTGCCACCACGCACAGG - Intronic
1114600646 14:23953493-23953515 AGGCAGCAGCCAAAGCCTGCGGG + Intergenic
1116013985 14:39384670-39384692 AGGCACCTGGCTGAGTGTGCCGG - Intronic
1118404974 14:65413382-65413404 AGGCATCCGCCAGAGCGTCCCGG - Intronic
1118856575 14:69628074-69628096 AGGCACCTGCCACCACGCCCAGG + Intronic
1119028840 14:71175711-71175733 AAGCACCTGCCAAAGCCAGCAGG - Intergenic
1120845235 14:89119417-89119439 AGGCAGCTGACAGAGCGTGGGGG + Intergenic
1121627037 14:95393281-95393303 AAGCACATGCCACAGGGAGCTGG + Intergenic
1121792546 14:96709966-96709988 AAGCACCTTCCCCAGCCTGCAGG + Intergenic
1122234956 14:100326186-100326208 AGGCATCTGGCACTGCGTCCGGG + Exonic
1122636026 14:103130085-103130107 CGGCCACTGCCACAGCGAGCTGG + Exonic
1122829829 14:104390416-104390438 AGGCACCGGGGACAGGGTGCAGG + Intergenic
1122880719 14:104689469-104689491 AGGGACCGGCCACAGTGGGCGGG + Intergenic
1123179007 14:106450152-106450174 AGGTCCCAGCCAGAGCGTGCAGG - Intergenic
1202885965 14_KI270722v1_random:107467-107489 AGACACCAGCCACAGTGTTCTGG + Intergenic
1123896813 15:24838176-24838198 AGGCACCTGCCACCACGCCCAGG + Intronic
1124178837 15:27454060-27454082 AGGCAGCTGCCACACTGAGCAGG + Intronic
1124371595 15:29107446-29107468 AGGAACATGCCACAGAGGGCTGG - Intronic
1128646189 15:69380470-69380492 AGGCATCTGCCACAGAGTTGTGG + Intronic
1128730201 15:70015693-70015715 AGGCACAGGCCACAGCGGGAGGG + Intergenic
1129227214 15:74176961-74176983 AGGCCCCTGCCACTGTGGGCAGG - Intergenic
1130715572 15:86330111-86330133 AGGCAGCAGCCACAGTGGGCAGG - Intronic
1131216975 15:90545718-90545740 AGGCACCTGCCACCACGCCCGGG + Intronic
1133386461 16:5374059-5374081 AGGCACCTGCCATCATGTGCAGG + Intergenic
1135294510 16:21267632-21267654 CTGCACCTGCCACAGCCTCCTGG + Exonic
1135949714 16:26902738-26902760 TGACACCTGCCACTGCATGCAGG + Intergenic
1136591015 16:31217756-31217778 AGGCACTTGCCACAGCGCCCAGG + Intronic
1138473712 16:57258359-57258381 AGGCACCTGCCACCTCCTGAGGG - Intronic
1138525095 16:57600555-57600577 AGTCACCTGGCAGAGCCTGCGGG + Intergenic
1138670524 16:58610697-58610719 AGGCACCTGCCACCACGTCTGGG - Intronic
1140579300 16:76210326-76210348 GGGCAGCTGCCACAGCATGACGG - Intergenic
1141649685 16:85386226-85386248 AGGCACCTGCCACGGCGTCAGGG - Intergenic
1142276472 16:89121383-89121405 AGGCACCCACCTCCGCGTGCAGG - Intronic
1143481730 17:7231084-7231106 AGGCAGCCGCATCAGCGTGCGGG - Intronic
1145033829 17:19526044-19526066 AGGCGCCTGCCACTGCGCCCGGG + Intronic
1146091319 17:29881643-29881665 AGGCACCTGCCACCGCACCCAGG + Intronic
1146206963 17:30913297-30913319 AGGCACCTGCCACAGTGCCCTGG + Intronic
1146486307 17:33245806-33245828 AGGCAGATGCCAGAGTGTGCAGG + Intronic
1147557257 17:41487278-41487300 ACGCACCAGCCTCAGCGTGCAGG - Intronic
1148346323 17:46905890-46905912 AGGGACCTGCCCCAGTGTGAAGG + Intergenic
1149473406 17:56938354-56938376 AGGCACCTGGCTGAGTGTGCTGG - Exonic
1150290734 17:63980148-63980170 GAGCACCTGCTACAGTGTGCTGG + Intergenic
1152068010 17:78121988-78122010 AGGCCCCTGCCCCAGCGGGCAGG - Intronic
1152490287 17:80627161-80627183 AGGCACCTGCCACCACGCCCAGG + Intronic
1152603276 17:81276202-81276224 TGGCACCTGTCACAGTGGGCAGG + Intronic
1152748838 17:82053237-82053259 AGGCACCTGGCACCTCGTCCTGG - Intronic
1152895603 17:82909439-82909461 ATGCGCCTCCCACAGCGGGCCGG - Intronic
1152895636 17:82909575-82909597 ATGCGCCTCCCACAGCGGGCCGG - Intronic
1152895652 17:82909641-82909663 ACGCGCCTCCCACAGCGGGCCGG - Intronic
1152895668 17:82909707-82909729 ACGCGCCTCCCACAGCGGGCCGG - Intronic
1153892962 18:9535084-9535106 TGGCACCTGCCACAGAGTGGAGG + Intronic
1154176775 18:12091397-12091419 AGGCCCCTGCCCCTGCGCGCAGG + Intergenic
1154416254 18:14177548-14177570 AGGCACCTACCACAGGCTGGAGG + Intergenic
1154492440 18:14932248-14932270 AGGCCACTGCCACAGCCTTCAGG - Intergenic
1157566638 18:48683030-48683052 ATGAACCATCCACAGCGTGCTGG + Intronic
1157646797 18:49281912-49281934 GGGTACATGGCACAGCGTGCAGG - Intronic
1160033747 18:75283082-75283104 AGGCCCCTCCCACTGTGTGCGGG - Intronic
1160529148 18:79553442-79553464 AGTCACCTGTCACTGAGTGCCGG + Intergenic
1161644894 19:5447158-5447180 AGGCACTTGCCCCAGCCTGGCGG - Intergenic
1162173254 19:8808162-8808184 AGGCACCTGCCACCACGCCCAGG - Exonic
1164070165 19:21760349-21760371 AGGCACCTGCCATCACATGCAGG - Intronic
1164648171 19:29873854-29873876 CGGCACCGGCCACCGCGCGCTGG - Intergenic
1165006999 19:32815310-32815332 CGGCGCTTGCCACAACGTGCAGG - Intronic
1165059156 19:33196272-33196294 AGGCACCTGCCACCGCACCCTGG - Intronic
1165145539 19:33727769-33727791 AGGCTCCTGCCGTAGCGGGCTGG + Intronic
1167015977 19:46841497-46841519 GGACACCTGCCCCAGCCTGCAGG - Intronic
1167651719 19:50734512-50734534 AGGCACCTGCCACCACGCCCAGG + Intergenic
1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG + Intergenic
1202661365 1_KI270708v1_random:74447-74469 AGACACCAGCCACAGTGTTCTGG + Intergenic
925235499 2:2273630-2273652 AGGCACCTGCCCCAGGGTAGGGG + Intronic
925396911 2:3540550-3540572 AGGCACCTGCCACCGCGCCTGGG + Intronic
927448748 2:23188305-23188327 AGGCACCTGCCACAGGAAGAAGG + Intergenic
928920043 2:36517436-36517458 GTGCACCTGCCACAGCGGACGGG + Exonic
929996498 2:46829353-46829375 AGGCACATGCCCCAGAGGGCTGG + Intronic
930114183 2:47704924-47704946 AGGCACCTGCCACTGTGCCCAGG + Intronic
931355338 2:61532897-61532919 AGGCATGAGCCACCGCGTGCTGG - Intronic
932233276 2:70100606-70100628 AGGCACCCGCCACAGCGCTCAGG + Intergenic
932592893 2:73077770-73077792 ATGTACCTGTCACAGGGTGCTGG - Intronic
934731050 2:96658158-96658180 AGGCACCTGCTACTACGTGTGGG + Intergenic
935765185 2:106359586-106359608 AGGCCCCTGCCACTGGGTGTTGG + Intergenic
940981913 2:160012766-160012788 AGGCACCTGCCACCACGCCCTGG - Intronic
944247325 2:197544607-197544629 AGGCACACGCCACAGCGCCCGGG - Intronic
945762792 2:213935056-213935078 AGGCACCTGCCACCACGCCCAGG - Intronic
946812233 2:223538105-223538127 AGGCAGCTGCCACAGCGAATAGG - Intergenic
948756456 2:240162294-240162316 AGGCACCTTACTCAGCCTGCTGG + Intergenic
948807763 2:240460337-240460359 AGGCTCCTGACTCAGGGTGCAGG - Intronic
948907855 2:240988351-240988373 AGGCAGGTGCCAGAGAGTGCAGG + Intronic
1169978788 20:11360480-11360502 AGGCGCCTGCCACCGCGCCCGGG + Intergenic
1170602638 20:17852938-17852960 AGGCACCCGCCACCGCGCCCGGG + Intergenic
1170658369 20:18312814-18312836 AAGCACCTGCCTCAGCGTCCTGG + Intronic
1172142853 20:32735748-32735770 AGGCTCCTGCCTCAGCCTCCTGG + Intronic
1172855393 20:37998071-37998093 AGGCGCCTGCCACTGCGCCCAGG + Intronic
1173806104 20:45926260-45926282 AGGCACGTGCCACTGGGTCCAGG - Intergenic
1174205431 20:48834898-48834920 AGGCACCTGCCACCACGCCCAGG + Intergenic
1175397417 20:58675843-58675865 GGGCACTTGCCACGGCCTGCAGG + Intronic
1176218868 20:63960665-63960687 AGGCACCTGCAGCAGGGGGCTGG + Intronic
1176268666 20:64223971-64223993 AGGCACCAGCTATAGCTTGCTGG + Intronic
1176857091 21:13981749-13981771 AGGCACCTACCACAGGCTGGAGG - Intergenic
1176867511 21:14062478-14062500 AGGCACCTACCACAGGCTGGAGG + Intergenic
1177152647 21:17470208-17470230 AGGCACGTGCCACCACGTCCAGG + Intergenic
1178251666 21:31009267-31009289 AGGCACCTGCCACCACGCCCAGG + Intergenic
1178621207 21:34178034-34178056 AGGCATCTGTCACAGTGTGTTGG - Intergenic
1181529171 22:23506650-23506672 AGGCACCTGCCACCACGCCCCGG - Intergenic
1182151386 22:28029460-28029482 AGGTCCCTGCCACAGCCTGAAGG - Intronic
1182797794 22:33004011-33004033 TGGCACCTTCCACATGGTGCTGG + Intronic
1182934646 22:34209556-34209578 AGGCAGGTGCCAGAGCATGCAGG - Intergenic
1183409551 22:37646913-37646935 AGGCACCTGCCACAGCGTGCGGG - Exonic
1183463843 22:37969016-37969038 AGGCAGCCGCCCCAGAGTGCGGG + Exonic
1183494020 22:38132266-38132288 TGGCACCTGCCACAGGCTGCTGG + Intronic
949571129 3:5294210-5294232 AGGCACCTGCCACCACGCCCAGG - Intergenic
951624010 3:24640158-24640180 AGGAAGCTGTCACAGCGTACTGG - Intergenic
952737603 3:36705911-36705933 AGGCACCTGCCACCACGCCCAGG + Intergenic
953354993 3:42248517-42248539 AGGCACCAGCCACAGCCTTCAGG - Intergenic
954084776 3:48235492-48235514 AGGCACCTGCCACCACGTCCGGG + Intergenic
954696906 3:52432398-52432420 ACCCACCTGGCACAGTGTGCTGG - Intergenic
955502335 3:59597748-59597770 AGGCACGAGCCACTGCGTCCAGG + Intergenic
956873289 3:73439040-73439062 AGGCACCTGGGAAAGTGTGCAGG - Intronic
959978566 3:112488755-112488777 AGGCACCTGCCACTGCGCCCGGG + Intronic
960279096 3:115760997-115761019 AGGCACCTGCCACATCCATCAGG - Intergenic
962829358 3:139126391-139126413 GGGCACCAGCCAGAGTGTGCAGG + Intronic
964890613 3:161530051-161530073 AGACACCTACCACAGAGTGATGG - Intergenic
966860952 3:184230603-184230625 CGGCCCCTGCCTCAGCGTGCGGG + Exonic
967905123 3:194492979-194493001 AGGCACCTGCCACTGTGCCCGGG - Intronic
968579085 4:1381391-1381413 CCGCACCTGCCTCAGTGTGCAGG + Intronic
969342858 4:6553235-6553257 AGGCACCAGTCAGAGCTTGCAGG - Intronic
970617359 4:17780926-17780948 AGGAAACTCCCACAGCCTGCTGG - Intronic
970866630 4:20766457-20766479 AGTCTCCTGCCTCAGCCTGCTGG - Intronic
973221974 4:47736968-47736990 AGGCATTTGCCACAGAGGGCAGG + Intronic
973280618 4:48357523-48357545 AGGCACCTGCCACCGTGCTCAGG + Intronic
975423040 4:74191692-74191714 AGGCACCTGCCACCACGCCCAGG + Intronic
975783740 4:77866193-77866215 AGGCACATGCCACTGGGTCCGGG + Intronic
978533205 4:109734658-109734680 AGGCACCTGCCACCACGCCCAGG - Intergenic
978655443 4:111060521-111060543 AGGCACCTGCCACCACGCTCGGG + Intergenic
985273053 4:188212595-188212617 AGGCACCTGCCACCACGCCCAGG + Intergenic
989167880 5:38448395-38448417 AGGCACCTTCCTCAGCTTTCTGG + Intronic
992684321 5:79184822-79184844 AGTCACCTGCCTCAGCCTCCTGG - Intronic
996521829 5:124436157-124436179 AGGCACATGCCACTGCACGCAGG - Intergenic
998758969 5:145411359-145411381 GGGCACCTCCCACAACATGCGGG + Intergenic
1000525882 5:162356993-162357015 AGGCACCTGCCACCACGCCCAGG + Intergenic
1001248017 5:170120191-170120213 AGGCACCTGCCACCACGCCCTGG + Intergenic
1004345051 6:14841641-14841663 AGGCACCTGCCACCACGTCTAGG + Intergenic
1004648472 6:17585716-17585738 AGGCGCCTGCCACAACGTCTGGG - Intergenic
1006083819 6:31582339-31582361 TGGCTCCTGCCACAGCTAGCAGG + Exonic
1006630968 6:35429279-35429301 AGGCACCAGCCCCAGTGTGAGGG + Intergenic
1007208540 6:40172384-40172406 AGGCAGCTGCCTCAGCCTGGTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007609731 6:43141801-43141823 TCGCACCTGCCACAGTGAGCTGG - Exonic
1009165769 6:60339502-60339524 AGGCACCTGCCACCACGCCCGGG + Intergenic
1010199725 6:73272303-73272325 AGGCACCTGCCACCACGTCGGGG + Intronic
1010632019 6:78209377-78209399 AGGCACCTGCCACAATGCCCGGG + Intergenic
1010970400 6:82256938-82256960 AGGCACCTGCCACCATGCGCGGG - Intergenic
1013288194 6:108698349-108698371 AAGCACCTGCCACAGCTGTCTGG - Intergenic
1013415562 6:109921479-109921501 AGGCACCTGCCACCACGCCCAGG + Intergenic
1015101376 6:129485802-129485824 GGGCACCTGCCACACAGTGATGG - Intronic
1015146987 6:129998063-129998085 AGGCACCTGCCACCACGCCCGGG + Intergenic
1017846609 6:158263917-158263939 AGGCACCTGCCACCACGCCCAGG - Intronic
1018034006 6:159866551-159866573 AGGAGCCTGCAACAGCGTCCTGG + Intergenic
1019593045 7:1845162-1845184 TGACACCTGGCACAGCCTGCTGG + Intronic
1019612568 7:1944436-1944458 ATGCAGCTGCCAGAGCCTGCGGG + Intronic
1019780654 7:2937880-2937902 AGGCACCACCTGCAGCGTGCAGG - Intronic
1021352026 7:19605662-19605684 AGCAACTTGCCACAGCTTGCAGG + Intergenic
1022114245 7:27248619-27248641 GGGCACCTGCTACTGTGTGCAGG - Intergenic
1024929729 7:54657499-54657521 AAGCACTGGCCCCAGCGTGCCGG - Intergenic
1025093216 7:56079739-56079761 AGGCGCCTGCCACAGAGGGATGG - Exonic
1025771450 7:64511124-64511146 AGGCACCTGCCACAGTGCCTAGG - Intergenic
1028392618 7:90334388-90334410 AGGCAGCTCCCTCAGCCTGCGGG + Intergenic
1034413933 7:150955337-150955359 AGCCACCTGCCTCAGTGTGCCGG + Intronic
1034620687 7:152454528-152454550 ATCCACCTGCCTCAGCCTGCTGG + Intergenic
1034640188 7:152596209-152596231 AGGCACCTGCCACCACATCCAGG - Intergenic
1035821106 8:2593109-2593131 AGGCACCTGCCACTACGCCCGGG - Intergenic
1036677764 8:10849449-10849471 AGGCACCTTCCAAAGTGTGCTGG + Intergenic
1036703378 8:11029024-11029046 AGGCACCAGGCACAGGGTGGGGG - Intronic
1038267187 8:26046262-26046284 AGGCTGCTGCCACCGCCTGCCGG - Intergenic
1039194553 8:35016251-35016273 AGGCGCCTGCCACGGCGCCCAGG - Intergenic
1039347701 8:36726148-36726170 ATGGACCTGCAACAGCTTGCTGG + Intergenic
1044656953 8:94558207-94558229 AGGCATATGCCACAGCGCCCGGG - Intergenic
1045103215 8:98866030-98866052 AAGCAGCAGCCACAGTGTGCAGG - Intronic
1047514741 8:125544518-125544540 CGGCACTTGCCACAGTGGGCTGG - Intergenic
1047524666 8:125622503-125622525 AGGCACCTGCCACTGCACCCAGG + Intergenic
1048375372 8:133818331-133818353 AGGCCCCTGCCACAGCATGTGGG - Intergenic
1049031865 8:140043968-140043990 AGACTCCAGCCACAGCCTGCAGG + Intronic
1049045044 8:140143120-140143142 AGGCAGCTGAGACAGTGTGCTGG + Intronic
1049479328 8:142813231-142813253 AGGCACCTCCCACAACATGTGGG + Intergenic
1049531980 8:143159547-143159569 AGGCACCTGACCCAGCCCGCGGG + Intronic
1050285647 9:4099107-4099129 GGGCACCTGCAGCAGCCTGCAGG + Intronic
1053024475 9:34718647-34718669 AGCCACCTCCCACATGGTGCAGG + Intergenic
1053035885 9:34826456-34826478 AGCCACCTCCCACATGGTGCAGG + Intergenic
1053845462 9:42231815-42231837 AGGCACCTGCCACCACGCCCAGG + Intergenic
1056276344 9:84997845-84997867 TGGCATCTGCCACAGCGAGGGGG - Intronic
1057782982 9:98064997-98065019 AGGCCCCTGCCCCAGGTTGCAGG - Intronic
1058543756 9:106039406-106039428 AGGGACCTGCCACACTGTGATGG + Intergenic
1060463965 9:123885921-123885943 AGGCACCTGCCACCATGTCCGGG + Intronic
1060787671 9:126463530-126463552 AGAGACCTGCCACAGAGTGTCGG - Intronic
1062256462 9:135624871-135624893 AGGCACCTGCCACCACGCCCAGG + Intronic
1185487642 X:495152-495174 GGGCACCTGTCACACCGTCCCGG + Intergenic
1187067556 X:15855085-15855107 AGGCACCTGCAAGAGCGCGCGGG - Intergenic
1187496897 X:19803061-19803083 TGGCAGCTTCCACAACGTGCAGG + Intronic
1189362501 X:40363609-40363631 AGGCACCTGCCACCACGCCCTGG + Intergenic
1190161784 X:48037062-48037084 AGGCACGTGCCACCACGTCCAGG - Intronic
1192792104 X:74392840-74392862 AGGCACCTGCCACCACGCCCAGG - Intergenic
1200089234 X:153626566-153626588 AGGCCCCAGCCACAGCGCCCCGG - Intergenic
1201391276 Y:13500039-13500061 AGGCACCTGCCACCACATTCAGG - Intergenic