ID: 1183411130

View in Genome Browser
Species Human (GRCh38)
Location 22:37655553-37655575
Sequence AACCCTGCACAGGTGGACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183411111_1183411130 28 Left 1183411111 22:37655502-37655524 CCCAGCCCGGCCTCCCCAGGTCC 0: 1
1: 0
2: 4
3: 119
4: 2690
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411125_1183411130 -7 Left 1183411125 22:37655537-37655559 CCCAGTCTCTTTGAGTAACCCTG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411117_1183411130 14 Left 1183411117 22:37655516-37655538 CCCAGGTCCAGCCTCCCCCAGCC 0: 1
1: 0
2: 6
3: 79
4: 692
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411119_1183411130 7 Left 1183411119 22:37655523-37655545 CCAGCCTCCCCCAGCCCAGTCTC 0: 1
1: 0
2: 23
3: 159
4: 1231
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411112_1183411130 27 Left 1183411112 22:37655503-37655525 CCAGCCCGGCCTCCCCAGGTCCA 0: 1
1: 0
2: 3
3: 71
4: 698
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411122_1183411130 -1 Left 1183411122 22:37655531-37655553 CCCCAGCCCAGTCTCTTTGAGTA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411109_1183411130 30 Left 1183411109 22:37655500-37655522 CCCCCAGCCCGGCCTCCCCAGGT 0: 1
1: 0
2: 6
3: 150
4: 1660
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411124_1183411130 -3 Left 1183411124 22:37655533-37655555 CCAGCCCAGTCTCTTTGAGTAAC 0: 1
1: 0
2: 1
3: 19
4: 135
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411115_1183411130 18 Left 1183411115 22:37655512-37655534 CCTCCCCAGGTCCAGCCTCCCCC 0: 1
1: 0
2: 7
3: 94
4: 1056
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411114_1183411130 22 Left 1183411114 22:37655508-37655530 CCGGCCTCCCCAGGTCCAGCCTC 0: 1
1: 2
2: 26
3: 111
4: 874
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411118_1183411130 13 Left 1183411118 22:37655517-37655539 CCAGGTCCAGCCTCCCCCAGCCC 0: 1
1: 2
2: 19
3: 188
4: 1505
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411116_1183411130 15 Left 1183411116 22:37655515-37655537 CCCCAGGTCCAGCCTCCCCCAGC 0: 1
1: 0
2: 8
3: 94
4: 664
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411110_1183411130 29 Left 1183411110 22:37655501-37655523 CCCCAGCCCGGCCTCCCCAGGTC 0: 1
1: 0
2: 5
3: 67
4: 684
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411123_1183411130 -2 Left 1183411123 22:37655532-37655554 CCCAGCCCAGTCTCTTTGAGTAA 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411121_1183411130 0 Left 1183411121 22:37655530-37655552 CCCCCAGCCCAGTCTCTTTGAGT 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411113_1183411130 23 Left 1183411113 22:37655507-37655529 CCCGGCCTCCCCAGGTCCAGCCT 0: 1
1: 0
2: 9
3: 128
4: 778
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411126_1183411130 -8 Left 1183411126 22:37655538-37655560 CCAGTCTCTTTGAGTAACCCTGC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1183411120_1183411130 3 Left 1183411120 22:37655527-37655549 CCTCCCCCAGCCCAGTCTCTTTG 0: 1
1: 0
2: 24
3: 85
4: 952
Right 1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183411130 Original CRISPR AACCCTGCACAGGTGGACCT GGG Exonic
901148334 1:7083536-7083558 AGCCCTGCCCTGTTGGACCTGGG + Intronic
901615961 1:10539956-10539978 AACCCTGCATAGTGGGGCCTGGG + Intronic
902660430 1:17897032-17897054 GACCCTGGACAGGAGGCCCTGGG - Intergenic
904767432 1:32861267-32861289 AACCCTACACAGCTAGACTTGGG - Intergenic
905664670 1:39755819-39755841 AACCCTGCACAGGTAAACTGAGG + Intronic
909717507 1:78727521-78727543 AAACCTGCATAGGTGTACCATGG - Intergenic
910445116 1:87291873-87291895 AAGCCTGAACAGGTGGACTTGGG + Intergenic
916556905 1:165901140-165901162 ACCCCTGCAACGCTGGACCTGGG - Intronic
919971860 1:202585783-202585805 AAGCCTGCAGAGGTGGAAATTGG + Exonic
920310145 1:205043847-205043869 CACCCTGCAGAGGTAGACCCTGG - Intronic
1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG + Intergenic
1068717577 10:60205270-60205292 AACCCTGCACAAGACGACCTTGG - Intronic
1072188849 10:93064771-93064793 AAACCTGCAAAGATGGGCCTAGG - Intronic
1074716772 10:116227036-116227058 AACCCTGGACAGTAGGAACTGGG - Intronic
1075417320 10:122274303-122274325 AACCCTGCATAGATGGACTGTGG + Intronic
1076856920 10:133121317-133121339 ACACGTGCACAGGTGCACCTGGG - Intronic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1081869752 11:46377894-46377916 ACCCCTGCAGAGGGGGTCCTGGG - Intronic
1088157248 11:106822384-106822406 AAACCTGCACATGTGCTCCTTGG - Intronic
1092870589 12:12802360-12802382 AACCCTCCACATGAGCACCTGGG - Intronic
1094023222 12:25936132-25936154 ACCTCTGCACAGGAGGACCCTGG + Intergenic
1094465426 12:30749159-30749181 AACCCTGCAGAAGTGTGCCTGGG + Intronic
1094831466 12:34302192-34302214 GACCCTGCACAGGTGTTGCTAGG - Intergenic
1102032897 12:109753258-109753280 CACCCTCCTCAGCTGGACCTTGG + Intronic
1102741788 12:115213886-115213908 AAGTCTGCAGATGTGGACCTGGG + Intergenic
1104211059 12:126688846-126688868 AACCCTGGACAGGTGGTCTGAGG - Intergenic
1105707392 13:22976819-22976841 ACCCCTGAGCAGGTGGTCCTGGG - Intergenic
1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG + Intronic
1113386928 13:109857518-109857540 AACCCTGCAGAGCTGAGCCTAGG + Intergenic
1113891060 13:113735858-113735880 GAGCCTGCACAGAGGGACCTGGG - Exonic
1119860528 14:77932811-77932833 AAACCTGGTCAGGTGGTCCTGGG - Intronic
1121600402 14:95199094-95199116 AGCCCTGCCCATGTGGCCCTCGG + Intronic
1122299730 14:100724863-100724885 AACCCTGGTCAGGAAGACCTTGG + Intergenic
1122384723 14:101336567-101336589 TGTCCTGCACAGGTGGACATTGG - Intergenic
1122836816 14:104434594-104434616 ACCCCTGAGCAGGTGGTCCTGGG - Intergenic
1122942293 14:104986799-104986821 AACCATGCCAGGGTGGACCTTGG + Exonic
1123042283 14:105495344-105495366 AGGCCTGCCCAGGGGGACCTAGG + Intronic
1123047808 14:105527069-105527091 GACCCAGGACAGGTGGGCCTGGG + Intronic
1124268164 15:28256078-28256100 TGCCCTGCGCAGGTGGGCCTGGG - Exonic
1127745657 15:61969001-61969023 AACCCTGGAAATGTGGCCCTAGG - Intronic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1131650317 15:94391292-94391314 AACCCATCACAGGTGAAACTTGG - Intronic
1135425987 16:22336100-22336122 AAACCTGCAGGGGTGGGCCTAGG - Intergenic
1136086385 16:27888195-27888217 AACCCTGCCCACGTGGGCCCCGG + Intronic
1139079286 16:63495495-63495517 ATCCCTTCACAGGAGCACCTAGG + Intergenic
1140795455 16:78433604-78433626 AGGCCTTCACAGTTGGACCTAGG + Intronic
1141619609 16:85229953-85229975 AGCCCTGGACAACTGGACCTAGG - Intergenic
1145019390 17:19417655-19417677 AGCCCTGCAGAAGTGGTCCTGGG - Intergenic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1146569302 17:33939040-33939062 AAGCCTTCAAAGGAGGACCTAGG - Intronic
1148217877 17:45843632-45843654 AAGCCTGGACAGGAGGTCCTGGG + Intergenic
1148953656 17:51335916-51335938 GACCCTGCAGTGGTGGACCAAGG + Intergenic
1150314659 17:64158406-64158428 AGCCCTGGACAGGTGGCCATGGG + Intronic
1151975006 17:77479743-77479765 AACCCTCCCCAGCAGGACCTGGG - Intronic
1152461840 17:80445764-80445786 ACCCCTGGCCAGGTGGCCCTGGG + Intergenic
1152599049 17:81252350-81252372 CAGCCTGCAAAGGAGGACCTGGG - Exonic
1152611408 17:81316579-81316601 GACCCTGGCCAGGTGGCCCTTGG + Intronic
1152946795 17:83202312-83202334 AAGCCTGCAGAGGTGACCCTTGG + Intergenic
1153463936 18:5368043-5368065 AGCCCTGCAAAGTTGGAGCTGGG + Intergenic
1157280881 18:46345526-46345548 ATCCCTGCACAGGTGCACCTGGG + Intronic
1157752605 18:50193312-50193334 ATCGCTGCACAGGTGGCCCCTGG + Intronic
1159917910 18:74202590-74202612 AACCCTGGGCAGGGGGTCCTTGG + Intergenic
1163297174 19:16419908-16419930 AACCTTCCACAGGTGGGCCTTGG - Intronic
1164122145 19:22275561-22275583 AACCCTGCATAGATGAACGTGGG - Intergenic
1165321340 19:35087090-35087112 GTCCCTCCGCAGGTGGACCTGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168097883 19:54125808-54125830 AACCCAGGACGGGTGGGCCTGGG + Intronic
924980053 2:211135-211157 AGTTCTGCACAGGTGGTCCTGGG - Intergenic
925591786 2:5517124-5517146 ATCTTTGCACAGCTGGACCTTGG - Intergenic
926155760 2:10453179-10453201 AGCCCTTCACTGGTGGCCCTGGG + Intergenic
927864042 2:26577421-26577443 AACCCTGCCCAGGTGCAGCGAGG + Intronic
930462639 2:51702854-51702876 AAGCCTGCATATGTGGAACTGGG + Intergenic
931505538 2:62922381-62922403 AACCCTCCAAAGGTAGACTTTGG + Intronic
934962645 2:98690403-98690425 AACCCTGCACAGCTGGAAGGAGG + Intronic
935025100 2:99269242-99269264 AACCCAGCACAGGTGGTCACAGG - Intronic
937992965 2:127674494-127674516 ACCCCTGCACAGCTGGTGCTTGG + Intronic
939527491 2:143315566-143315588 CATCCTGCACAGGAGCACCTGGG - Intronic
948685746 2:239668603-239668625 CACCCTGCCCACGTGCACCTTGG + Intergenic
948692778 2:239717393-239717415 AGCCCAGCTCAGGTGGAACTTGG - Intergenic
1170982386 20:21226822-21226844 AAAACTGCCCAGGTGGGCCTCGG + Intronic
1171507257 20:25647790-25647812 AGCTTTGCACAGGTGCACCTGGG + Intergenic
1174066331 20:47868319-47868341 AAGCCTGCAGAGGCGGACCCAGG - Intergenic
1174067662 20:47877395-47877417 AGACCTGAACAGGTGCACCTTGG - Intergenic
1174157746 20:48527772-48527794 AAGGCTGCAGAGGTGGACCCAGG + Intergenic
1178514132 21:33231197-33231219 AAGCCTGCACAGGTGGATAGGGG - Intronic
1179177841 21:39021696-39021718 AGCCCTCCACAGGGGGACCCAGG - Intergenic
1180080283 21:45483525-45483547 AACCCTGCAGAGGAGGGGCTGGG + Intronic
1181501697 22:23319070-23319092 AGCCCTGCACTGGTGGACTGGGG + Intergenic
1181610218 22:24006968-24006990 CACCTTGCACAGGTAGACATTGG + Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183174644 22:36213844-36213866 AAGTGTGCAAAGGTGGACCTGGG + Intergenic
1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG + Exonic
949476651 3:4453090-4453112 ACCCCTACACAGGTACACCTTGG - Intronic
951328300 3:21332423-21332445 AACCCTAGACAGGCAGACCTTGG - Intergenic
954007113 3:47600345-47600367 AACTCAGCACTGGTGTACCTGGG + Intronic
968971048 4:3794076-3794098 GCCCCTGAAAAGGTGGACCTGGG - Intergenic
968984059 4:3865901-3865923 AAAGCTGGACAGGTGGACATGGG + Intergenic
969392432 4:6900706-6900728 AACCCAGAACAGGTGGGCCTGGG - Intergenic
971181975 4:24337233-24337255 GACCCTCCACAGGTGGAATTGGG - Intergenic
977639700 4:99343027-99343049 AACACAGCACAGGTAGACCCTGG + Exonic
982528852 4:156512147-156512169 AACTCTGTAGAGGTGCACCTGGG + Intergenic
985587840 5:750176-750198 GACCCTGACCAGGAGGACCTGGG - Intronic
985602507 5:842643-842665 GACCCTGACCAGGAGGACCTGGG - Intronic
985656329 5:1133420-1133442 AACCCTGCCCTGCTGGTCCTGGG + Intergenic
986412744 5:7497700-7497722 AACCATGCCCAGGTGGAATTAGG + Intronic
986559168 5:9043645-9043667 AACCCTGGACAGATGGCCATTGG - Intronic
987459570 5:18192217-18192239 AACTGTACACAGGTAGACCTTGG + Intergenic
988498412 5:31764081-31764103 AATCCTGCTCAGGAGGAACTCGG + Intronic
988698263 5:33646035-33646057 AACCCTGCACAGTGGTTCCTTGG - Intronic
995516601 5:112960433-112960455 GCCCCTGCACAGATGGATCTAGG - Intergenic
1004798308 6:19115066-19115088 AACCCTGTACAGGCAAACCTTGG + Intergenic
1005391625 6:25339768-25339790 AACCCTGCTCAGTGTGACCTTGG + Intronic
1008078589 6:47171199-47171221 CACCCTGCACAGGAGGTCCTTGG - Intergenic
1016351916 6:143177797-143177819 AGCCCTGGACAGCTGGTCCTTGG + Intronic
1019387114 7:763519-763541 CACACAGCACAGGTGGTCCTGGG - Intronic
1021262335 7:18473481-18473503 ATCCATGCACATGTGCACCTGGG - Intronic
1022438175 7:30410012-30410034 AGCACAGCACAGGTGGAGCTGGG - Intronic
1026837243 7:73647323-73647345 AACCCTGTCCAGGTGGGCCCTGG - Intergenic
1027267899 7:76504142-76504164 CATCCACCACAGGTGGACCTTGG - Intronic
1027319710 7:77004004-77004026 CATCCACCACAGGTGGACCTTGG - Intergenic
1035333703 7:158112635-158112657 CATCCTGCACACGTGGACATGGG + Intronic
1035585650 8:771087-771109 ACCCCAGCACAGGAGGACCAAGG - Intergenic
1038578341 8:28724909-28724931 CACCCAGCTCAGGAGGACCTAGG - Intronic
1039168782 8:34716892-34716914 AAACCTGCACATGTGTCCCTTGG - Intergenic
1039637584 8:39182908-39182930 AACCGTGGACAGGCAGACCTTGG + Intronic
1039657910 8:39430304-39430326 AAACCTGCACATGTGCCCCTCGG - Intergenic
1040815784 8:51507448-51507470 AACTCTGCAAAGATGGACTTGGG + Intronic
1045659196 8:104418940-104418962 CACTCTGCACAGGAGCACCTCGG - Intronic
1048161317 8:132024548-132024570 GACCCTCCACAGGAGGACCTCGG - Exonic
1049741901 8:144244925-144244947 AACCCAGCCCAGGTGGATCCAGG - Intronic
1050807529 9:9699911-9699933 AACCCTGTACAGCAGGAGCTTGG + Intronic
1052320879 9:27165930-27165952 AACCATGCTCAGAAGGACCTGGG - Intronic
1056601624 9:88051425-88051447 AGACCTGCACAGGAGGCCCTGGG + Intergenic
1056617916 9:88184280-88184302 AACCCTACACTGGTGAACCTGGG - Intergenic
1057242382 9:93422993-93423015 AACCCTGCCCAGCTGAACCTTGG + Intergenic
1059906454 9:118991838-118991860 AACCCTTCACAGGCTGATCTGGG + Intergenic
1060266167 9:122112580-122112602 AACCCTGGGAAGGTGGACTTTGG + Intergenic
1186067274 X:5779321-5779343 AATCCTCCACAGCTGTACCTTGG + Intergenic
1188922963 X:36001781-36001803 AACCCTCCACAGATAGATCTTGG - Intergenic
1197854750 X:130902920-130902942 TCCCCTGCAGAGGTGGAGCTGGG + Intronic
1198233261 X:134713829-134713851 GACCCTGTACACGTGGACCCTGG - Intronic