ID: 1183413396

View in Genome Browser
Species Human (GRCh38)
Location 22:37668609-37668631
Sequence CTTTTAAAGGACATAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183413389_1183413396 2 Left 1183413389 22:37668584-37668606 CCACCGCGCCTGGCTGTTTGCCT No data
Right 1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG No data
1183413391_1183413396 -6 Left 1183413391 22:37668592-37668614 CCTGGCTGTTTGCCTCACTTTTA No data
Right 1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG No data
1183413390_1183413396 -1 Left 1183413390 22:37668587-37668609 CCGCGCCTGGCTGTTTGCCTCAC No data
Right 1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG No data
1183413387_1183413396 29 Left 1183413387 22:37668557-37668579 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG No data
1183413386_1183413396 30 Left 1183413386 22:37668556-37668578 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183413396 Original CRISPR CTTTTAAAGGACATAGAGGA GGG Intergenic
No off target data available for this crispr