ID: 1183415022

View in Genome Browser
Species Human (GRCh38)
Location 22:37676920-37676942
Sequence CTCCACTGCTCGAAGTGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183415022_1183415038 27 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415038 22:37676970-37676992 GGGCTTGTCTGTGCAGGGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 253
1183415022_1183415025 -4 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415025 22:37676939-37676961 GGAGGCCTTGTCCTCTAACCCGG 0: 1
1: 0
2: 1
3: 11
4: 100
1183415022_1183415026 0 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415026 22:37676943-37676965 GCCTTGTCCTCTAACCCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1183415022_1183415028 1 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415028 22:37676944-37676966 CCTTGTCCTCTAACCCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1183415022_1183415030 6 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415030 22:37676949-37676971 TCCTCTAACCCGGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 171
1183415022_1183415029 5 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415029 22:37676948-37676970 GTCCTCTAACCCGGCTGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
1183415022_1183415032 7 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415032 22:37676950-37676972 CCTCTAACCCGGCTGGGCCGGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1183415022_1183415036 22 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415036 22:37676965-37676987 GGCCGGGGCTTGTCTGTGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 168
1183415022_1183415035 21 Left 1183415022 22:37676920-37676942 CCCGGACACTTCGAGCAGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1183415035 22:37676964-37676986 GGGCCGGGGCTTGTCTGTGCAGG 0: 1
1: 0
2: 1
3: 38
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183415022 Original CRISPR CTCCACTGCTCGAAGTGTCC GGG (reversed) Intronic
900126397 1:1070728-1070750 CTGCCCTGCCCCAAGTGTCCTGG + Intergenic
901433603 1:9233342-9233364 CTCCACAGCTGGAAGTGAGCAGG - Intergenic
901600821 1:10422146-10422168 CACCACTGCTCCAGGGGTCCAGG - Intergenic
902219415 1:14955439-14955461 CTCCACTCCTGGAAGAGTCTGGG + Intronic
904603119 1:31684360-31684382 CTCCTCTGCTAGGAGTGTCAGGG - Intronic
910272194 1:85408870-85408892 CTCCTCTGCTCCAAGTGACAAGG - Intronic
912532970 1:110339702-110339724 CTCGACTGCTGGACTTGTCCAGG - Exonic
914091488 1:144503849-144503871 CTCCTGTGCTGGAAGTATCCTGG - Intergenic
917269104 1:173253933-173253955 CTCCACTTCTGTAACTGTCCTGG - Intergenic
924089982 1:240492316-240492338 CTGCTCTGCTCGAGGTTTCCCGG + Exonic
1063015910 10:2076747-2076769 CTCCACTGCCCCCATTGTCCCGG + Intergenic
1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG + Intergenic
1067862364 10:49864598-49864620 CTACACTTCTTTAAGTGTCCTGG + Intronic
1073928011 10:108539742-108539764 CTCCACTGCTTCGAGTTTCCTGG - Intergenic
1075841914 10:125512045-125512067 CTTCATTTCTCCAAGTGTCCAGG + Intergenic
1079075978 11:17385916-17385938 CAACACTGCTCCAAGGGTCCAGG + Exonic
1085112353 11:73899154-73899176 CTCCTCTGCTGGAAATGTCCAGG - Exonic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1088530994 11:110809199-110809221 CACCACTGCTCAAACTGTCAAGG - Intergenic
1106603538 13:31207825-31207847 CTCCACTGGCTGAATTGTCCTGG + Intronic
1108541587 13:51452025-51452047 CTCCTCTGCTGGCAGGGTCCCGG + Exonic
1108593586 13:51932117-51932139 TTCCACTCTTTGAAGTGTCCTGG + Intergenic
1114264984 14:21068725-21068747 CTCCACGGCTCTAACTGTGCGGG + Intronic
1116858256 14:49972952-49972974 CTTCTCTGCCTGAAGTGTCCAGG - Intergenic
1117554299 14:56868831-56868853 CTGCACTGTCCAAAGTGTCCAGG + Intergenic
1119233252 14:72997886-72997908 CACCACTGCTCGCTGTGGCCTGG - Exonic
1119304862 14:73599440-73599462 CACCACTGTTCGAAGTGACACGG + Intergenic
1120952252 14:90052014-90052036 CTTCACTGCCAGATGTGTCCTGG - Intergenic
1121550537 14:94796237-94796259 CTCCACGGGTCCAAGTTTCCAGG - Intergenic
1129457884 15:75685339-75685361 CTCCACTGCTCCGTGTCTCCGGG - Exonic
1149567159 17:57648597-57648619 CTCCACTGCTGGAAATGTGGTGG - Intronic
1149575332 17:57707875-57707897 GAGCACAGCTCGAAGTGTCCCGG - Intergenic
1152027746 17:77822701-77822723 CTCCACTGCCGGAAGAATCCAGG - Intergenic
1153710776 18:7796643-7796665 CTCCACTGCTCTAAGTCTGGTGG - Intronic
1165062659 19:33212427-33212449 CTCAGCTCCTCGAAGTGTCCTGG + Exonic
1167499561 19:49837500-49837522 CCCCACTGCTCAAAGCCTCCTGG - Intronic
929547252 2:42863689-42863711 CCCCACTTCTCGAGGTGTCTGGG - Intergenic
936901336 2:117485064-117485086 CACCACTGCTGGAAATGTACTGG + Intergenic
945148104 2:206759960-206759982 CTCCACTGCTCATAGTTTCAGGG - Intronic
1170062866 20:12277232-12277254 CGCCACTGCTGGAACTGTGCCGG - Intergenic
1175680537 20:60985164-60985186 CTCCCCTCCCCGAGGTGTCCAGG - Intergenic
1183415022 22:37676920-37676942 CTCCACTGCTCGAAGTGTCCGGG - Intronic
1184259202 22:43305053-43305075 CCCCACTGCCCGCACTGTCCCGG + Intronic
951392970 3:22129899-22129921 CACCACAGCTGGGAGTGTCCTGG + Intronic
953886092 3:46715127-46715149 CTCCTCTGCCCCCAGTGTCCAGG + Intronic
954412037 3:50374996-50375018 CTCCACTTCTCAAACTCTCCTGG + Intronic
958578659 3:95987782-95987804 CTCCACTGGTCAATGTGACCCGG + Intergenic
958837594 3:99163510-99163532 CACCACTGCTTGGAGTGTGCTGG - Intergenic
961467203 3:127089193-127089215 GGCCACTGCTCTGAGTGTCCTGG + Intergenic
978467774 4:109027783-109027805 CTCCACTGCTCTAATTGCTCTGG - Intronic
980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG + Intergenic
986446441 5:7825474-7825496 CTCCAGTGCTGGAGGTGGCCAGG + Intronic
989287682 5:39721479-39721501 CTCCTCTGCTGGCAGGGTCCCGG + Intergenic
992431318 5:76714600-76714622 CTCCACGGATGTAAGTGTCCGGG + Intergenic
997674261 5:135701034-135701056 CTCCACTGCACAGAGTGACCTGG + Intergenic
1003667919 6:8128778-8128800 CTTCACTGCTCAAAGTGGCCTGG - Intergenic
1008130475 6:47715077-47715099 CTCCACTGCTGGGACTGACCTGG + Exonic
1035099561 7:156384968-156384990 CTCCACTGCTAGCAAGGTCCTGG + Intergenic
1036487620 8:9193961-9193983 CTCCACGGCTCTAAGAGTCAGGG - Intergenic
1048541586 8:135346969-135346991 CTCCAGTGCTAGCAGTGCCCTGG + Intergenic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1056541312 9:87573716-87573738 CTCCAATACTCCAAGTGTCCAGG + Intronic
1057177520 9:93010807-93010829 CTCCCCTGCTTGAAGTATGCGGG + Intronic
1187852941 X:23609011-23609033 CTACACTGCTAGAAGGGTCAAGG + Intergenic
1188722735 X:33543451-33543473 CTCCACTGCTGGGCATGTCCGGG - Intergenic
1189163301 X:38833406-38833428 CTCCTCTGCTCAAAGTGGGCAGG - Intergenic
1190391887 X:49940217-49940239 CTCCACTCTCCAAAGTGTCCTGG + Intronic
1197718200 X:129725521-129725543 CTACACTGTGCGAACTGTCCAGG - Intergenic
1200418748 Y:2939841-2939863 CTACACTGCTCTAAGTGACCGGG - Intronic