ID: 1183419638

View in Genome Browser
Species Human (GRCh38)
Location 22:37703799-37703821
Sequence GTATCAAGACTGGTAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183419638_1183419643 23 Left 1183419638 22:37703799-37703821 CCAGCTTCTACCAGTCTTGATAC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1183419643 22:37703845-37703867 TCACCTGCAAGTTCAGGTTCAGG 0: 1
1: 0
2: 1
3: 20
4: 184
1183419638_1183419642 17 Left 1183419638 22:37703799-37703821 CCAGCTTCTACCAGTCTTGATAC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1183419642 22:37703839-37703861 TTGTGCTCACCTGCAAGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 135
1183419638_1183419644 24 Left 1183419638 22:37703799-37703821 CCAGCTTCTACCAGTCTTGATAC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1183419644 22:37703846-37703868 CACCTGCAAGTTCAGGTTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183419638 Original CRISPR GTATCAAGACTGGTAGAAGC TGG (reversed) Intronic
904452279 1:30621479-30621501 GGATCAAGACAGGTAGACACTGG - Intergenic
905530255 1:38672799-38672821 GTATAAAGCCTGCTGGAAGCAGG + Intergenic
911422138 1:97656456-97656478 GTTTCAAGATTGGTAGTACCAGG - Intronic
911485642 1:98501561-98501583 GTATCTAGTCTGGCATAAGCAGG + Intergenic
923242279 1:232097468-232097490 GTAGCAAAGCTGGTAGAAGCAGG + Intergenic
1063895686 10:10679153-10679175 TTATCAAGAATGGTAGGAGATGG + Intergenic
1064833835 10:19503151-19503173 GTATCAAGAATGATATAATCAGG - Intronic
1066347147 10:34598963-34598985 GTATCCACACTGGCAGAGGCTGG - Intronic
1066500528 10:35989304-35989326 GTATCAAGGCTGGTTGAACCCGG + Intergenic
1071032476 10:81201626-81201648 AAATCTTGACTGGTAGAAGCTGG - Intergenic
1074326613 10:112456690-112456712 CTATCAAGACTGGAATAAGGGGG - Intronic
1076187274 10:128459608-128459630 GTCACAAGACTGGGAGGAGCTGG + Intergenic
1076311957 10:129514939-129514961 GCATCAGGACTGACAGAAGCTGG + Intronic
1078428023 11:11267153-11267175 CAAACAAGACTGATAGAAGCAGG - Intergenic
1089876106 11:121723362-121723384 GAATCGAGACTGGTTGAAGGTGG + Intergenic
1092904289 12:13087973-13087995 GTAGCAAGTCTGTTAGTAGCAGG + Exonic
1104277025 12:127338607-127338629 GGATCAACACTTGTAGCAGCTGG + Intergenic
1106357982 13:29002380-29002402 GTATCAATTGTGGTATAAGCAGG - Intronic
1107566207 13:41607481-41607503 GTATCAAGGCTGACAGAAGCTGG + Intronic
1108414065 13:50179637-50179659 GCATCAAGACCGGCAGAGGCAGG - Intronic
1111978073 13:94988307-94988329 GTAACAATACGGGAAGAAGCAGG + Intergenic
1112166411 13:96924911-96924933 GTATGAGGACTGTTAGAAGTGGG - Intergenic
1112277884 13:98037677-98037699 GTATCAAAACTGCTATAGGCTGG - Intergenic
1112896415 13:104305294-104305316 TTATCTAGACTGTTAGATGCAGG - Intergenic
1121309507 14:92928028-92928050 GCATCAAGCCTGGAAGGAGCTGG - Intronic
1121387429 14:93541123-93541145 GGATCTAGACTGGTACAAGTCGG + Intronic
1121551677 14:94807523-94807545 GTCTCAAGGCTCGTAGTAGCAGG + Intergenic
1124423583 15:29542769-29542791 GTAGCCAGACTCATAGAAGCAGG - Intronic
1131519322 15:93101412-93101434 GTATCAAGATTAGTAGAATCTGG - Intergenic
1133077711 16:3292471-3292493 GGATCAACAGTGGTAGGAGCAGG + Intronic
1133728055 16:8555583-8555605 GATTGAAGACTGGTGGAAGCTGG - Intergenic
1135561520 16:23480240-23480262 GAATCAAGACTGCTTGGAGCTGG - Intronic
1138897012 16:61218850-61218872 TTAGCAACACTGGCAGAAGCTGG - Intergenic
1140837723 16:78810696-78810718 GTATCAAGGGTGGAAGAAGGTGG + Intronic
1146719483 17:35113704-35113726 GAATCAGGAGTGGTAGAGGCTGG - Intronic
1147524835 17:41212770-41212792 GCAACAAGACTGGCAGCAGCTGG - Intronic
1147531525 17:41282956-41282978 GTCTCTAGACTGGTAGGGGCAGG - Intergenic
1149416247 17:56462786-56462808 CTGTCAAGACTGGTAGCAGAGGG - Intronic
1160523080 18:79520102-79520124 GAATCAAAACTGGTAGAATGAGG + Intronic
1165367529 19:35377789-35377811 TGATCAACACTGGTAGAAGTGGG + Intergenic
1168423791 19:56222774-56222796 GTGTCCAAACTGGTGGAAGCAGG + Intronic
928706936 2:33960058-33960080 TTAACAAAACTGGTAGCAGCAGG - Intergenic
930262077 2:49158879-49158901 CTATCAATACTTGTAGAAGAGGG - Intergenic
930301107 2:49617087-49617109 GACTCAAGACTGGGAGAAGTAGG - Intergenic
930756301 2:54976908-54976930 GTATCGAGACTGGAGGAAGGAGG + Intronic
932894782 2:75629130-75629152 TTATCAATACTGATAGAATCAGG + Intergenic
934108285 2:88716583-88716605 GTATCCAGACTGGAAAATGCTGG + Intronic
936100474 2:109573300-109573322 GTATAAAGATTTGTAGAAGCTGG - Intronic
936743658 2:115546864-115546886 GCATCAAGAATGGGAGGAGCTGG - Intronic
938256027 2:129860742-129860764 GTGTCATGACTGCTACAAGCTGG - Intergenic
940818031 2:158318297-158318319 GTAGCCAGACTGGTAGAGCCAGG - Intronic
942394730 2:175535240-175535262 GAATGGAAACTGGTAGAAGCAGG + Intergenic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1177060426 21:16367140-16367162 GTATTAAGATTGCTAAAAGCAGG + Intergenic
1183419638 22:37703799-37703821 GTATCAAGACTGGTAGAAGCTGG - Intronic
950308530 3:11935714-11935736 GTATTAACACAGGTAGAAGCTGG - Intergenic
951592167 3:24278262-24278284 TTTTCAGGACTGGCAGAAGCAGG + Intronic
951802703 3:26613986-26614008 GTACCATGATTCGTAGAAGCAGG + Intergenic
953899082 3:46828918-46828940 GAATAAAGATTGGTAGAGGCTGG - Intergenic
955762345 3:62300599-62300621 GAAACAAGAGTGGCAGAAGCAGG + Intergenic
958889091 3:99763433-99763455 TTATCATTACTGGTAGAGGCAGG - Intronic
966347631 3:178997178-178997200 GTATTAATACTGATATAAGCAGG + Intergenic
967913306 3:194559551-194559573 GTATAAATGCTGGGAGAAGCAGG - Intergenic
968355919 3:198106740-198106762 CTATCAAGACTGTTAGAGGAGGG - Intergenic
975262465 4:72319788-72319810 GAAACAATACTGGGAGAAGCAGG + Intronic
975496436 4:75040671-75040693 GTATCAACATTAGTGGAAGCTGG + Intronic
976141554 4:81998527-81998549 GTATCAAGCCTGGGAGAATGAGG + Intronic
976321194 4:83717930-83717952 GTCTCAGGGGTGGTAGAAGCAGG - Intergenic
977052306 4:92143844-92143866 GTATCAAGGCTGGAAGAAAATGG + Intergenic
979078914 4:116310094-116310116 GTTTTAAGACTGGGAGTAGCTGG + Intergenic
981786141 4:148481693-148481715 GGATCAAGACTGGAAAAAGGGGG - Intergenic
981816242 4:148834096-148834118 TTATTTAGACTGGTAGAAGTTGG + Intergenic
982754677 4:159204110-159204132 GCATCATGCCTAGTAGAAGCTGG - Intronic
983048475 4:163014928-163014950 GGATCAGGACAGGTGGAAGCAGG + Intergenic
983406375 4:167336028-167336050 GTAGCAAGACAGGTATGAGCAGG - Intergenic
986008004 5:3684216-3684238 GTATCCACACTGGAAGAAGTGGG + Intergenic
986968820 5:13307830-13307852 GTTTTAAGAGTGGTAGAAGCTGG - Intergenic
986994849 5:13595547-13595569 ATACCAAGACTGGTAGGAGGTGG - Intergenic
991287326 5:64992366-64992388 GAATCACTGCTGGTAGAAGCTGG - Intronic
993448633 5:88046178-88046200 TTCTTAAGAATGGTAGAAGCAGG - Intergenic
995095894 5:108235508-108235530 GCATCAAGAATGGCAGAAGGAGG - Intronic
1000122896 5:158214474-158214496 TTATCAAGACTTGTACAACCTGG + Intergenic
1000128837 5:158274962-158274984 AGCTCAAGACAGGTAGAAGCAGG + Intergenic
1005587229 6:27288576-27288598 GTATCTAGACTGGCAGCTGCCGG + Intronic
1008521661 6:52367472-52367494 GTATCATGACTGGTAGATCTAGG + Intronic
1009992107 6:70856061-70856083 CTATGAAGACTAGTAAAAGCTGG - Intronic
1011139699 6:84139594-84139616 CTAGCAAAACTGGCAGAAGCTGG + Intronic
1012705653 6:102525571-102525593 GCTGCAAGACTGGCAGAAGCAGG + Intergenic
1013825732 6:114208796-114208818 GTATAAAGACTAGTTAAAGCAGG - Intronic
1014232774 6:118922733-118922755 GTATTAAGAATGGTTGAGGCCGG + Intronic
1015697175 6:135993512-135993534 GCAGCAAGACTGTTATAAGCTGG + Intronic
1016014371 6:139168575-139168597 GCACCAGGACAGGTAGAAGCAGG - Intronic
1020627581 7:10600937-10600959 GTATAAAGACTGGTAGTTACAGG + Intergenic
1020890753 7:13875375-13875397 GTATACAGAGTGTTAGAAGCAGG + Intergenic
1026382362 7:69812394-69812416 GCATCAAGCCTGGTAGGAGCTGG - Intronic
1027437436 7:78179198-78179220 GTATTAGAACTGATAGAAGCAGG + Intronic
1027823326 7:83077515-83077537 GCATGAAGTCTGGCAGAAGCTGG - Intronic
1028065851 7:86382625-86382647 GAAACAAGAATGGTAGGAGCAGG - Intergenic
1028850181 7:95529033-95529055 ATATCAATACTGGTAGCAACTGG - Intronic
1030529270 7:110692745-110692767 GTGTGAAAACTGCTAGAAGCAGG + Intronic
1033999804 7:147399317-147399339 GGAGCAAGAAAGGTAGAAGCAGG + Intronic
1034504968 7:151481469-151481491 GGATTAAGACTGGTAGTAGTAGG - Intronic
1038135826 8:24784590-24784612 GTATCTAGGCTGGTAGGAACGGG + Intergenic
1044780116 8:95735112-95735134 GAGTCAAGACAGGTGGAAGCTGG + Intergenic
1045441035 8:102210893-102210915 GTATCAAAACTTGTAGGAGCTGG - Intronic
1047308819 8:123675490-123675512 TTTTCAACACTTGTAGAAGCTGG + Intergenic
1055801060 9:80036753-80036775 TTATCAACACTGGTAAATGCTGG - Intergenic
1056750590 9:89348136-89348158 GTGTCATCACTGGTAAAAGCTGG - Exonic
1057866107 9:98682677-98682699 GTATTAAGATTGGTAAAATCAGG - Intronic
1058071241 9:100602479-100602501 GGACCAAGACTGGAACAAGCTGG - Intergenic
1062410409 9:136421301-136421323 ATTTCAAGTGTGGTAGAAGCCGG + Intronic
1195449986 X:105000375-105000397 GTATAAAGACAAGTACAAGCTGG + Intronic
1198334390 X:135652553-135652575 GTTTTAAGACTGGTAGAAGAGGG - Intergenic