ID: 1183427634

View in Genome Browser
Species Human (GRCh38)
Location 22:37747919-37747941
Sequence GGCTGCCGGAAGCAGCGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183427627_1183427634 13 Left 1183427627 22:37747883-37747905 CCTGTCCTGGGGGCAGCACGTGC 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1183427634 22:37747919-37747941 GGCTGCCGGAAGCAGCGTGTGGG No data
1183427628_1183427634 8 Left 1183427628 22:37747888-37747910 CCTGGGGGCAGCACGTGCTGAGC 0: 1
1: 0
2: 2
3: 29
4: 193
Right 1183427634 22:37747919-37747941 GGCTGCCGGAAGCAGCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183427634 Original CRISPR GGCTGCCGGAAGCAGCGTGT GGG Intronic
No off target data available for this crispr