ID: 1183429963

View in Genome Browser
Species Human (GRCh38)
Location 22:37759495-37759517
Sequence ACCCCGCCTGCAGGTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183429958_1183429963 16 Left 1183429958 22:37759456-37759478 CCACTGAGCTCTGAGAGGTTATG 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1183429963 22:37759495-37759517 ACCCCGCCTGCAGGTCTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183429963 Original CRISPR ACCCCGCCTGCAGGTCTCAA AGG Intronic
900342531 1:2195600-2195622 ACCCCTCCTGCAGGGCTCCCTGG + Intronic
905541908 1:38766649-38766671 CCTCCGCCTCCAGGGCTCAAGGG + Intergenic
907275611 1:53315124-53315146 ACCCCTCCTGAAGGTCCCTAAGG + Intronic
907309108 1:53529288-53529310 TCCTCACCTGCAGGGCTCAACGG + Intronic
908762003 1:67521413-67521435 ACTCCACCTCCCGGTCTCAAAGG + Intergenic
912467838 1:109886253-109886275 ACCCCTCCTGGGGGCCTCAATGG - Intergenic
917277025 1:173341904-173341926 ACCCCTTCTGGAAGTCTCAATGG + Intergenic
1063013051 10:2044588-2044610 ACCCCACTTCCAGGGCTCAATGG + Intergenic
1063598726 10:7461238-7461260 ACCCATCCTGCTGGGCTCAAGGG - Intergenic
1064781624 10:18845677-18845699 AGTCCTCGTGCAGGTCTCAAGGG - Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1077083262 11:735129-735151 ACCCCGCCTGAGGGTCTTCACGG + Intergenic
1077083338 11:735396-735418 ACCCCGCCTGAGGGTCTTCACGG + Intergenic
1077083354 11:735450-735472 ACCCCGCCTGAGGGTCTTCACGG + Intergenic
1077083401 11:735611-735633 ACCCCGCCTGAGGGTCTTCACGG + Intergenic
1083783029 11:64927891-64927913 GCCACACCTGCAGGTCTGAAGGG + Exonic
1084270860 11:68028380-68028402 ACCCAGCCAGGAGGTATCAATGG - Exonic
1089568161 11:119383519-119383541 ACCCAGCCTGTAGGTCCCCAAGG + Intergenic
1091656979 12:2353264-2353286 ACCCACCCTGCAAGTCTCCAAGG + Intronic
1094450702 12:30580374-30580396 TCCCCACCTGCAGGTGTCTATGG - Intergenic
1102450583 12:113039091-113039113 ACCCCGGCTTCAGGGCTCAGTGG - Intergenic
1103557905 12:121776869-121776891 CCTCCGCCTCCAGGGCTCAAGGG + Exonic
1105307438 13:19179039-19179061 GCCCTGCCTGCAGGGCACAATGG - Intronic
1111623203 13:90750310-90750332 CCACCGTCTGCAGGGCTCAATGG + Intergenic
1119874052 14:78042029-78042051 ACCCCACCTGAAGATCTCAGAGG - Intergenic
1122517033 14:102316095-102316117 ACCCAGCCTGCATGTCCCAGAGG - Intergenic
1122804555 14:104249983-104250005 ATGCTGCCTGCAGGTTTCAATGG + Intergenic
1129149079 15:73676127-73676149 CCTCCGCCTCCAGGGCTCAAGGG - Intergenic
1130160021 15:81389426-81389448 ACCTCACCTGCAGGACACAAGGG + Intergenic
1130524296 15:84690531-84690553 ACTCCACCTACCGGTCTCAAGGG - Intronic
1133282919 16:4677329-4677351 ACCCCGCTTCCAGATCACAACGG - Intronic
1136227070 16:28866414-28866436 ACCCACCCTGCAGCTCTCAAGGG - Exonic
1136576273 16:31127176-31127198 ACCCTGCCTGCAGATCACCAAGG + Exonic
1139433683 16:66924579-66924601 CCTCCGCCTTCAGGTTTCAAGGG - Intronic
1142337322 16:89497876-89497898 CCTCCGCCTCCAGGGCTCAAGGG - Intronic
1147460496 17:40565184-40565206 ACCCCTTCTCCAGGTCTGAAAGG + Intronic
1151488530 17:74417809-74417831 ACCCCTCCTGCAGGGACCAAGGG - Intergenic
1151969597 17:77450898-77450920 GCCCTGGCTGCAGGTCTGAATGG + Intronic
1152467533 17:80474576-80474598 TCCCCCACTGCAGGCCTCAATGG - Intronic
1155437749 18:25830943-25830965 ACCTGGACTGCAAGTCTCAAAGG + Intergenic
1160986107 19:1839686-1839708 ACGCAGCCTGCAGGGCACAAAGG + Intronic
1161252826 19:3290218-3290240 CCCCCACCTGCAGGTCCCGAGGG + Exonic
1161513260 19:4683228-4683250 ACCCCGCCAGCAGCTCTCTGTGG - Intronic
1165092922 19:33396089-33396111 ACCCCTCCTGCCGGCCGCAATGG - Intronic
1165214596 19:34261540-34261562 ATCCAGCCTGCAGTTCTCAGGGG + Intronic
925872609 2:8284171-8284193 CCCCGGCCTGCATGTCTCAGGGG + Intergenic
932185684 2:69693587-69693609 ACCCTGCCTGCAGGTCCCCAAGG + Intronic
932575701 2:72961272-72961294 ACCCCACCTTCGGGTCTCATGGG - Intronic
932713864 2:74087725-74087747 ACCCAGGGTGCAGGTCTTAACGG - Intronic
939517959 2:143192674-143192696 ACCCTGACTGGAGGTCTTAATGG - Intronic
947903847 2:233745250-233745272 ACACGGCCTGCAAGTCTTAATGG - Intronic
947905248 2:233756604-233756626 ACACGGCCTGCAAGTCTTAATGG - Intronic
948592920 2:239062948-239062970 GCCCAGGCTGCAGGTCCCAAGGG + Intronic
1170893716 20:20396255-20396277 TCCCCGCATGGAGGTCTCAGAGG + Intronic
1173491574 20:43487020-43487042 ACCCCTCCTGCTGCTCTCACTGG + Intergenic
1181423815 22:22819900-22819922 ACCCCGCCTGAAGGACTGGAGGG - Intronic
1183429963 22:37759495-37759517 ACCCCGCCTGCAGGTCTCAAAGG + Intronic
953409695 3:42683669-42683691 ACCCCACCAGCAGGTCCCAGAGG - Intergenic
953467618 3:43137563-43137585 ACCCCGCCTCCCAGGCTCAAGGG + Intergenic
954952926 3:54490848-54490870 ATCACACCTGCAGGGCTCAAGGG - Intronic
955404449 3:58617189-58617211 TCAGGGCCTGCAGGTCTCAATGG + Intronic
956815680 3:72906218-72906240 CCCCCGCCTGCAAGACTCACAGG - Intronic
958009289 3:87855480-87855502 ACTCCCCCAGCAAGTCTCAATGG + Intergenic
961652396 3:128423025-128423047 ACCCTTCCTGCAGGTCTCACTGG - Intergenic
967120571 3:186379045-186379067 ACTCCAACTGCAGGTATCAATGG - Intergenic
967778936 3:193414696-193414718 AGCCGTCCTGCAGGTCTGAAAGG + Exonic
968680945 4:1919079-1919101 ACCCCACCTTCAGGACTCAAGGG - Intronic
969096471 4:4736302-4736324 AGTCCGCCTGCAGGATTCAAAGG - Intergenic
969628340 4:8320223-8320245 ACCCTGCCTGCTGGCCTCCATGG + Intergenic
979446115 4:120813946-120813968 ACTCTGCCTGCAGGTATCAAAGG + Intronic
980182718 4:129421841-129421863 ACCCCGTCTTGAGGTCTCAGGGG + Intergenic
991715995 5:69451566-69451588 AACACAGCTGCAGGTCTCAAAGG - Intergenic
995462834 5:112420307-112420329 ACCCAGCCTCCAGGTCTCTCGGG - Intergenic
995543302 5:113205182-113205204 ACCCAGCCTGCAGCTTTCACAGG + Intronic
999838555 5:155400508-155400530 ACCCAGCCTGTGGTTCTCAAGGG + Intergenic
1006235237 6:32625170-32625192 TCCCCTCCTGCAGGTCTTCATGG + Intergenic
1006337788 6:33429489-33429511 ACCCAGCTGGCAGCTCTCAAGGG - Intronic
1007254534 6:40519579-40519601 GCCCAGCCTGCTGGTCTCAGGGG + Intronic
1016748955 6:147611617-147611639 ACCCCCACTGCAGGTCACAGTGG - Intronic
1018767467 6:166945291-166945313 TCACCCCCTGGAGGTCTCAAGGG + Intronic
1019429498 7:992191-992213 CCCCCGCCTCTAGGTCTCCAGGG + Intergenic
1019488130 7:1298869-1298891 ACCAAGCCTGCAGGTCCCCAAGG + Intergenic
1021033106 7:15763025-15763047 ACCCCACCTTCAGGGCCCAAAGG - Intergenic
1026665717 7:72337957-72337979 ACCCCTGCCCCAGGTCTCAAGGG + Intronic
1029041068 7:97575371-97575393 ACTCCGCCTCCTGGGCTCAAGGG + Intergenic
1034276173 7:149824774-149824796 ACCCCTCCTGCTTGTCTCTAAGG + Intergenic
1037800599 8:22033117-22033139 CCTCCCCCTGCAGGTCTCCATGG + Exonic
1037853898 8:22355777-22355799 ACCCGGTCTGGAGGTCTTAATGG - Exonic
1038251284 8:25907334-25907356 ACTCCGCCTCCTGGGCTCAAGGG - Intronic
1047112075 8:121801772-121801794 TTCCCGCCTGCTGGTCTAAAAGG + Intergenic
1052613975 9:30813920-30813942 AACCAGCCTGCCTGTCTCAATGG + Intergenic
1059972552 9:119682488-119682510 TCCCCACCTGCAGGTCCCTAGGG - Intergenic
1061880906 9:133568443-133568465 ACCCCGCCTGCGGGCCCCAGTGG + Exonic
1061883639 9:133580040-133580062 GCCCCGCCTGAAGGTCACAAGGG - Intronic
1062265451 9:135684759-135684781 CCCCCGCCTGGAGGGCACAACGG + Intergenic
1187781655 X:22833216-22833238 CCCCCGCCTCCCGGGCTCAAGGG - Intergenic
1189462782 X:41255419-41255441 CCCCCGCCTCCTGGGCTCAAGGG - Intergenic
1191689084 X:63921534-63921556 ATACAGCCTGCAGGCCTCAAAGG - Intergenic
1197678999 X:129362450-129362472 TCCCCTCCTCCAGGTCTCAGGGG - Intergenic