ID: 1183431003

View in Genome Browser
Species Human (GRCh38)
Location 22:37765729-37765751
Sequence GCTGCAGCGGCACCACGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183430998_1183431003 2 Left 1183430998 22:37765704-37765726 CCTCGCACCAGCAGGTGATGGAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG 0: 1
1: 0
2: 2
3: 23
4: 206
1183431000_1183431003 -5 Left 1183431000 22:37765711-37765733 CCAGCAGGTGATGGAGGAGCTGC 0: 1
1: 0
2: 5
3: 41
4: 370
Right 1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG 0: 1
1: 0
2: 2
3: 23
4: 206
1183430995_1183431003 19 Left 1183430995 22:37765687-37765709 CCTGGCAGAGATGGAGTCCTCGC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG 0: 1
1: 0
2: 2
3: 23
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183431003 Original CRISPR GCTGCAGCGGCACCACGAGC GGG Exonic
900409545 1:2506543-2506565 GCTGCAGCCCCACCGAGAGCAGG + Intergenic
903731818 1:25501988-25502010 GATGCAGCAGCCCCAAGAGCAGG - Intergenic
903813174 1:26046052-26046074 GCTGCAGCCGCAGCGGGAGCCGG - Exonic
903925247 1:26826962-26826984 GCGGCAGCGGCAGCGGGAGCGGG + Exonic
904047112 1:27615497-27615519 GCTGCTGCGGCACGACAAGCTGG - Exonic
905172902 1:36119526-36119548 CCTGCAGCGGCAGCAGGGGCTGG - Intronic
906717187 1:47979027-47979049 GCTACAGCCGCACCAGGAGTCGG + Intronic
906775584 1:48526515-48526537 GCTGCAGCGGCAGGAGGAGGAGG + Intergenic
907682789 1:56579505-56579527 GCGGCAGCAGCACCAACAGCAGG - Exonic
914992596 1:152511695-152511717 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915006650 1:152644542-152644564 GCTGCAGCAGCCCCCAGAGCTGG + Intergenic
915008662 1:152664278-152664300 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915009946 1:152676188-152676210 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915012321 1:152699062-152699084 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915017118 1:152744450-152744472 GCTGCAGCAGCCCCCAGAGCTGG - Intronic
915020741 1:152776532-152776554 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915021941 1:152787484-152787506 GCTGCAGCAGCCCCCAGAGCTGG - Exonic
915025706 1:152827633-152827655 GCTGCAGCCGCCCCCAGAGCTGG - Exonic
915163415 1:153934796-153934818 GCAGCAGCAGCAGCAGGAGCAGG - Exonic
918191810 1:182182969-182182991 GGTGCACAGGCACCACTAGCAGG - Intergenic
919103543 1:193122158-193122180 GCAGCGGCGGCGCCCCGAGCCGG + Exonic
920242308 1:204562228-204562250 ACTGCAGCCCCACCAGGAGCTGG - Intergenic
920340375 1:205271854-205271876 GCTGCAGCAGCAACAGCAGCAGG + Exonic
1065917709 10:30366573-30366595 GCTGCAGCTGGTCCATGAGCTGG + Intronic
1067045788 10:42984543-42984565 GCGGGTGCAGCACCACGAGCAGG - Intergenic
1072188785 10:93064401-93064423 GCTGCATCGGCACCTGGAGGGGG + Exonic
1072433233 10:95392155-95392177 GCTGGAGCAGCACCACGGACAGG + Intronic
1074886669 10:117699424-117699446 GCTGCAGCCTCACCATGGGCTGG - Intergenic
1076193722 10:128500182-128500204 TCTGCTGCACCACCACGAGCCGG - Intergenic
1076460767 10:130644597-130644619 ACTGAAGCTGCACCACGTGCTGG + Intergenic
1076754617 10:132562808-132562830 GCTGCAGAGGCCCCTCGAGAGGG + Intronic
1077413818 11:2415285-2415307 GCTGCAGCGGAAGCAGGAGGAGG - Exonic
1077426623 11:2482805-2482827 GCTGCAGGTGCACCAGGGGCAGG - Intronic
1078631843 11:13010302-13010324 GGTGCAGCGGCTCCACGAGCTGG + Intergenic
1079450628 11:20597531-20597553 GCCGGAGCGGTACCACGAGGCGG - Intergenic
1082023423 11:47553281-47553303 GCTGCAGCGCCCCCTCGGGCTGG + Intronic
1083079351 11:60073954-60073976 GCGGCAGCGGGAGCAGGAGCGGG + Intergenic
1083753688 11:64778047-64778069 GCTGCGGCGGCGACACGCGCTGG + Exonic
1084167710 11:67383753-67383775 CCTCCAGCGGCACCACGTGCTGG - Intronic
1085037576 11:73309235-73309257 GCCGCAGCAGCAACAGGAGCGGG + Exonic
1085266660 11:75241487-75241509 GCTGCAGCTCAACCACGCGCTGG + Exonic
1089494551 11:118901690-118901712 GCTGCTGCGGCACCAGCTGCTGG - Exonic
1089524484 11:119087999-119088021 ACTGCAGCGGCAGCAACAGCAGG + Intronic
1089746590 11:120621799-120621821 GCTGCAGCGGCAGTACAAGGGGG + Intronic
1090472268 11:126990614-126990636 TCTGAAGCCGCACCAAGAGCTGG - Intronic
1095654639 12:44654749-44654771 ACTGCAGAGGCACCGCGGGCTGG + Intronic
1096196118 12:49649828-49649850 GCTGCTGCGGCAATATGAGCGGG - Exonic
1096993270 12:55822059-55822081 GCTGCAGCGGCTCCAGGGGCAGG + Exonic
1098898015 12:76084621-76084643 GCGGCAGCGGCAGCAGCAGCGGG + Exonic
1100980543 12:100159020-100159042 GCTGCAGCCGGTCCACGAGCTGG + Intergenic
1104845620 12:131845325-131845347 GCTGCAGGGACACCAGGTGCCGG - Exonic
1113948500 13:114058259-114058281 GCAGCAGCAGCACCTGGAGCTGG - Intronic
1117176783 14:53153376-53153398 GCTGCACCGGCGCCGCGCGCGGG + Intergenic
1117436492 14:55719516-55719538 GCTGCAGAGGTAACAGGAGCTGG - Intergenic
1117867531 14:60165240-60165262 GCAGCAGCTGCACCAAGAGCAGG + Exonic
1118186560 14:63543190-63543212 TCTGCAGCGGCAGCAAGAGAAGG + Exonic
1121075003 14:91060512-91060534 GCTGCCGCGGCCCCAGGAGTCGG + Exonic
1122602936 14:102930283-102930305 GCAGCGGCGGCGCCACCAGCAGG - Exonic
1124328823 15:28789549-28789571 GCTGCTGCGGCGCCATGATCTGG - Intergenic
1124363419 15:29054814-29054836 GCTGAAGTGGCCCCACGAGCAGG + Exonic
1124962768 15:34410573-34410595 GCTGAAGTGGCCTCACGAGCAGG + Intronic
1124979394 15:34556795-34556817 GCTGAAGTGGCCTCACGAGCAGG + Intronic
1125510793 15:40291413-40291435 GCTGCAGCGGCGGCACGAGAAGG - Exonic
1127103158 15:55587957-55587979 GCCGCAGCGGCCCCGCGAGGAGG - Intronic
1127347619 15:58116374-58116396 GCAGTAGCGGCACCAAGAGGTGG + Intronic
1127772890 15:62244834-62244856 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1128153504 15:65377713-65377735 ACAGCAGCGGCAGCAGGAGCCGG + Exonic
1128454762 15:67826262-67826284 GCCGCAGCGGCGCGACGAGATGG - Exonic
1129030061 15:72611519-72611541 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129038286 15:72664267-72664289 GCTGCAGCTGGTCCACGAGCTGG - Intronic
1129211604 15:74072964-74072986 GCTGCAGCTGGTCCACGAACTGG + Intronic
1129333537 15:74839650-74839672 ACTGCAGCGGCTCCTGGAGCGGG - Exonic
1129398799 15:75268120-75268142 GCTGCAGCTGGTCCACGAACTGG - Intronic
1129402407 15:75292396-75292418 GCTGCAGCTGGTCCACGAACTGG - Intronic
1129483198 15:75843774-75843796 CCTGCTGCGGCACCAGGAACTGG - Exonic
1129728725 15:77917239-77917261 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1129839791 15:78736632-78736654 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129849988 15:78788257-78788279 GCTGCAGCGGGACCAGGTGAGGG + Exonic
1131282549 15:91033133-91033155 GCTGCAGCTGGTCCATGAGCTGG + Intergenic
1132461927 16:59731-59753 GCTGCATTGGCACCAAGGGCAGG - Exonic
1132696939 16:1206209-1206231 TCTTCACCAGCACCACGAGCTGG - Exonic
1132873501 16:2125759-2125781 CGTGCAGGGGCACCAGGAGCCGG - Intronic
1132892370 16:2210587-2210609 GCAGCAGCAGCAGCAGGAGCAGG + Exonic
1132941165 16:2509035-2509057 GCTGCACCTGCACCACGACCAGG - Intronic
1133210419 16:4260511-4260533 GCTGCAGCAGCAGCAGGAACAGG - Exonic
1133229769 16:4360942-4360964 GCTGCAGGGCCACCAAGACCAGG - Exonic
1134186322 16:12087900-12087922 GCGGCAGCAGCTCCACCAGCAGG - Exonic
1134552589 16:15144937-15144959 TGTGCAGGGGCACCAGGAGCCGG - Intergenic
1135113245 16:19707020-19707042 TCTGCAGCGGGACTACGACCGGG - Exonic
1136315801 16:29454199-29454221 GCTGCAGCGGGACCTGGAGGCGG - Exonic
1136430378 16:30193541-30193563 GCTGCAGCGGGACCTGGAGGCGG - Exonic
1136561548 16:31042145-31042167 GCGGCAGCGGCAGCAACAGCAGG - Intronic
1137053939 16:35734636-35734658 GCTGCTGTGGCACCAGGGGCTGG - Intergenic
1139466220 16:67155460-67155482 GTTGCAGCGGCACCGAGTGCTGG + Exonic
1142220674 16:88853487-88853509 GCTGCTGTGGCAACAGGAGCTGG + Intronic
1142348744 16:89570359-89570381 GCAGCAGTGGCACCATTAGCCGG + Intergenic
1147948431 17:44093374-44093396 GCAGCAGCGGCAGGAAGAGCTGG - Exonic
1148989179 17:51650661-51650683 GGTGCATCAGCACCAGGAGCAGG - Intronic
1150069456 17:62139111-62139133 GCTGCCTCTGCACCACGTGCCGG + Intergenic
1150692760 17:67378904-67378926 GCGGCCCCGGCACCACGTGCTGG - Intronic
1151518517 17:74612727-74612749 GCTTCAGAAGGACCACGAGCAGG + Exonic
1151681432 17:75624772-75624794 GCTGCAGGGGCCGCACCAGCTGG - Intergenic
1151816433 17:76473647-76473669 GCTGCATCGGCACCAAGGGCAGG - Exonic
1152667948 17:81582198-81582220 GCTGCAGCAGCACAACCAGGAGG + Intronic
1152775854 17:82201578-82201600 GCTGCAGCAGCAGCAGCAGCTGG - Exonic
1153043073 18:832269-832291 GCTGCAGCGGGACCTGGAGGCGG + Intergenic
1156219910 18:35041104-35041126 GCTGCAGTGGCAGCACGGGTCGG + Intronic
1156398634 18:36721015-36721037 GCTGCAGTGGGACCAAGAGAAGG - Intronic
1158572509 18:58609054-58609076 CCTGCACCTGCACCATGAGCAGG + Intronic
1159001557 18:62979374-62979396 GCTGCCGCGGCACTACCAGCTGG + Exonic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160727214 19:622656-622678 GCTGCCTCTGCACCACGTGCCGG + Exonic
1161844947 19:6707100-6707122 GCTGCGGCGGCAGCACGCGCGGG - Exonic
1161865179 19:6828120-6828142 GCTGCATAGGCACCATCAGCAGG - Exonic
1162032274 19:7922710-7922732 GCTCCAGGGGCACCAGGAACGGG - Exonic
1162032996 19:7925406-7925428 ACAGCACCAGCACCACGAGCAGG + Exonic
1162328047 19:10010319-10010341 GCTGCAGCGCGGCCAGGAGCAGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162951331 19:14073501-14073523 GATGCAGCGGGACATCGAGCGGG + Exonic
1163702029 19:18790843-18790865 GCTGCTGCGGCAGCAGGTGCGGG - Exonic
1164156590 19:22601193-22601215 GCTGCAGCTGGTCCATGAGCTGG - Intergenic
1164617338 19:29674942-29674964 GCTGCAGCGGCAGCTCCAGATGG + Exonic
1165091889 19:33392075-33392097 GCTGGCACGGCCCCACGAGCTGG + Intronic
1165204565 19:34172629-34172651 GCGGCGGCGGCGCCATGAGCGGG + Exonic
1165745978 19:38229613-38229635 GCGGCAGCGGCGCCCCGGGCCGG - Intronic
1165923870 19:39315123-39315145 GCCGCAGCTCCACCACGCGCCGG + Exonic
1166044713 19:40223215-40223237 GCCGCAGCCGCACGACGACCCGG + Exonic
1166546992 19:43639782-43639804 GCGGCGGCGGCACCATGGGCCGG - Exonic
1166732014 19:45064477-45064499 GCGGGAGCGGGACCAGGAGCGGG - Exonic
1166748340 19:45152510-45152532 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
1167306702 19:48713939-48713961 GCTGGAGCTGCAGCAGGAGCCGG + Exonic
1167503526 19:49860144-49860166 CCTGCAGCGGAACCTGGAGCAGG + Exonic
925077723 2:1032175-1032197 GCTGCAGCGGGACCACGGGCTGG + Intronic
926219086 2:10923236-10923258 TCTCCAGCGGCACCCAGAGCCGG + Intergenic
927494943 2:23545953-23545975 CCTGCAGCGGCACACAGAGCAGG - Intronic
929492290 2:42407628-42407650 GCTGCAGCTGCCCCCCAAGCGGG - Intronic
929958817 2:46480665-46480687 GCGGCAGCGGCAGCACGAGGTGG + Exonic
929958823 2:46480704-46480726 GCGGGAGCGGCAGCACGAGGTGG + Exonic
931429225 2:62196142-62196164 GCAGCAGCGGCAACAAGTGCCGG + Exonic
932740921 2:74290726-74290748 GCTGCAGCAGAACCTCAAGCAGG + Intronic
932767845 2:74482531-74482553 GCTGCGGCTGCATCGCGAGCGGG - Exonic
935318225 2:101859049-101859071 GCAGCAGCTGCTCCAGGAGCAGG + Exonic
935592766 2:104856356-104856378 GCCGCACCCGCACCACGCGCAGG + Exonic
937307219 2:120879636-120879658 GCTGCGGCCCCACCACGGGCTGG + Intronic
937378322 2:121353223-121353245 GCAGCAGAGGCACCACCAGAAGG + Intronic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
945036496 2:205708048-205708070 GCGGCAGCAGCAGCACTAGCAGG - Intronic
945179152 2:207074341-207074363 GCTGAGGCGACACCACCAGCTGG + Exonic
946291677 2:218750125-218750147 GCTGCAGCAGCTCCACCACCAGG + Exonic
946363744 2:219235797-219235819 GCAGCAGAGGCAGCAGGAGCAGG + Exonic
948139040 2:235659550-235659572 GCTGCAAAGGGACCCCGAGCAGG - Intronic
948643783 2:239391377-239391399 GCTGCAGAGACACCCTGAGCAGG + Intronic
948671441 2:239571194-239571216 GCTGCAGTGGCACAGAGAGCTGG - Intergenic
948843732 2:240672980-240673002 GCTGCAGCGGCGCCAGCTGCGGG - Intergenic
1174449239 20:50609526-50609548 GCAGCAGGGGCAGCAAGAGCTGG - Intronic
1175423805 20:58852101-58852123 GCTGCGGCGGCACCAAGAGAGGG - Intronic
1179991630 21:44951242-44951264 GCTTCAGCGCCACCAGGAGATGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180933195 22:19607340-19607362 GGTGCATCGGCACCAAGGGCAGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181235456 22:21445581-21445603 GCTGCAGCAGCAGCACCAACGGG + Exonic
1182460745 22:30481878-30481900 GCAGCAGCAGCAGCAGGAGCAGG + Intergenic
1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG + Exonic
1183599818 22:38833336-38833358 ACTGCAGGGGCACCAGGACCAGG + Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950546568 3:13641517-13641539 GCTGCAGTGGCCCCAGGACCAGG - Intergenic
952383018 3:32818807-32818829 GCTGCTGCGGCACCGGGACCCGG - Exonic
952936729 3:38404473-38404495 GCTCCAGCTGCACCAAGAGTAGG + Intronic
954292449 3:49656756-49656778 GCTGCAGAGGCACCGTGAGGAGG + Exonic
956659525 3:71583920-71583942 ACTCCAGCGGCCCCCCGAGCGGG + Intronic
960329311 3:116338820-116338842 GCTGCAGTGGCACCCCAAGGTGG + Intronic
961835142 3:129651732-129651754 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
962129829 3:132660561-132660583 GCAGCAGCGGGTCCAGGAGCTGG + Exonic
968132184 3:196198286-196198308 GCTGCAGCCTCACCACGCCCCGG + Exonic
972960376 4:44447061-44447083 GCGGCAGCTGCACCAACAGCAGG + Intronic
973279307 4:48342069-48342091 GCCGCTGCGGCCCGACGAGCTGG + Exonic
973916077 4:55636111-55636133 GCAGCAGCAGCAGCAGGAGCGGG + Exonic
976686985 4:87824960-87824982 GCCTCAGCGGCCCCAAGAGCTGG + Intronic
984769099 4:183422244-183422266 ACTCCAGCAGCTCCACGAGCTGG + Intergenic
985444676 4:190015423-190015445 GCCGCAGCCCCACCAGGAGCCGG + Intergenic
985896719 5:2753178-2753200 GCTGCAGCCGCACCACAGGGAGG - Intronic
987374000 5:17217789-17217811 GCTGCATAGGCACCCAGAGCCGG + Exonic
992690422 5:79236210-79236232 TCTGCAGCAGCACCAGGGGCGGG + Exonic
998295565 5:140966494-140966516 GCTGTAGCGGCAGCAGCAGCAGG + Exonic
1001382013 5:171311434-171311456 GTTGCAGCTGCAGCATGAGCCGG - Exonic
1001577323 5:172772465-172772487 GCTGCAGCGACGCGACGCGCTGG + Intergenic
1002163724 5:177332269-177332291 GCTGAAACGGCAGCACGGGCCGG + Intronic
1002423981 5:179165145-179165167 GCTCCAGCGGGACCACCTGCTGG + Intronic
1002592739 5:180302461-180302483 GCTGCAGCGGAATCACGCTCAGG + Exonic
1006169730 6:32086008-32086030 GCAGCAGCGCCCCCAGGAGCTGG - Intronic
1006425399 6:33960041-33960063 CCTGCAGGGGCATCACCAGCAGG - Intergenic
1010569927 6:77463950-77463972 GCTGCAGCGGCCGCCAGAGCTGG + Intergenic
1011282427 6:85690215-85690237 GTTGCAGTGGCACCACCAGTAGG + Intergenic
1013155823 6:107490338-107490360 GCGGCGGCGGCAGCAGGAGCCGG + Exonic
1013422535 6:109979230-109979252 GCTGCGGCGGCTCTAGGAGCCGG + Exonic
1014459806 6:121682911-121682933 GCTGCGGTGGCACCATGAGCGGG + Intergenic
1014947693 6:127516371-127516393 GCTGCAGCAGCAGCAACAGCAGG - Exonic
1016648206 6:146434433-146434455 GCTGCAGCGGCAGCATCTGCAGG - Exonic
1018948767 6:168364995-168365017 GCAGCAGAGGCACCCAGAGCAGG + Intergenic
1019713806 7:2529403-2529425 GGTGCAGAGGCACCAGGAGGGGG - Intergenic
1020012935 7:4816297-4816319 GCTGCAGGTGCACCCCGAGGTGG - Exonic
1020275450 7:6622014-6622036 GTTGGAGCGGCAGCAGGAGCTGG + Exonic
1022414077 7:30163423-30163445 CCCGCTGCTGCACCACGAGCAGG - Intergenic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024238917 7:47418978-47419000 GCTGCAGGGGCAGCACCAACCGG + Intronic
1027539661 7:79452591-79452613 GGTGCAGCGGCATCACCAGCGGG - Intronic
1029547320 7:101217223-101217245 GCAGCAGCGGCAGCAGCAGCAGG + Exonic
1030925310 7:115445366-115445388 GTTTCAGCAGCACCACCAGCAGG + Intergenic
1031918200 7:127582646-127582668 GCTGCAGCAGCTCCACCGGCAGG - Exonic
1032125377 7:129189187-129189209 GCAGCAGCAGCCCCAGGAGCGGG - Exonic
1033186496 7:139231601-139231623 GCCGCAGCCGTACCGCGAGCCGG + Exonic
1035028095 7:155839582-155839604 GCTGCACCTGCACATCGAGCAGG - Intergenic
1037811419 8:22089262-22089284 CCTGCAGCAGCGCCCCGAGCCGG - Exonic
1038484132 8:27921655-27921677 GCTGCAGCTGAAGCAGGAGCTGG - Exonic
1049058090 8:140254641-140254663 GCTGGAGGGGCACCAGGAGGAGG - Intronic
1049419623 8:142510964-142510986 GCGGCAGCCGCGCCACGACCAGG - Exonic
1049573918 8:143381923-143381945 GCAGCAGCGACACCACCTGCAGG - Exonic
1049682901 8:143927655-143927677 GCAGCAGCGGCACGGGGAGCGGG - Exonic
1049998464 9:1052069-1052091 GCTGCCGCTCCACCACCAGCAGG - Exonic
1052115919 9:24648662-24648684 GCTGCAGCTGCACCTGGAGAGGG - Intergenic
1056122775 9:83505666-83505688 GCTCAGGCAGCACCACGAGCAGG - Intronic
1059769834 9:117414803-117414825 GCGGCGGCGGCAGCAGGAGCAGG + Exonic
1060480624 9:124015042-124015064 GCAGCAGCGGCACCTGGAGGAGG + Intronic
1060838745 9:126777920-126777942 GCTGCAGCAGCACCACCTCCAGG + Intergenic
1061062848 9:128259229-128259251 GCTGCAGCTGGTCCACGAGCTGG + Exonic
1189054660 X:37686159-37686181 GGTGCAGCAGCAGTACGAGCGGG - Exonic
1192473685 X:71420801-71420823 GCTGCCGCTGGACCCCGAGCCGG - Intronic
1193467499 X:81867084-81867106 GCTGCAGCCTCACAAAGAGCTGG - Intergenic
1194444695 X:93973670-93973692 GCTGAGGTGGCACCAAGAGCGGG - Intergenic
1198426053 X:136521278-136521300 GCTGCAGCAGCAGCACCACCTGG - Intergenic
1201073189 Y:10168769-10168791 GCTGCAGCCCCACCAGGAGCCGG + Intergenic
1201739737 Y:17311116-17311138 GCTGCAGCAGCAGCAGGAGGAGG - Intergenic