ID: 1183433438

View in Genome Browser
Species Human (GRCh38)
Location 22:37779843-37779865
Sequence TTAAGCACAAAGCTAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183433438_1183433442 -4 Left 1183433438 22:37779843-37779865 CCAAGCTCTAGCTTTGTGCTTAA No data
Right 1183433442 22:37779862-37779884 TTAACCCAGTGGGAGGCTATTGG No data
1183433438_1183433443 -3 Left 1183433438 22:37779843-37779865 CCAAGCTCTAGCTTTGTGCTTAA No data
Right 1183433443 22:37779863-37779885 TAACCCAGTGGGAGGCTATTGGG No data
1183433438_1183433444 -2 Left 1183433438 22:37779843-37779865 CCAAGCTCTAGCTTTGTGCTTAA No data
Right 1183433444 22:37779864-37779886 AACCCAGTGGGAGGCTATTGGGG No data
1183433438_1183433447 22 Left 1183433438 22:37779843-37779865 CCAAGCTCTAGCTTTGTGCTTAA No data
Right 1183433447 22:37779888-37779910 ATTTTATGTGAGCAGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183433438 Original CRISPR TTAAGCACAAAGCTAGAGCT TGG (reversed) Intergenic
No off target data available for this crispr