ID: 1183434079

View in Genome Browser
Species Human (GRCh38)
Location 22:37783285-37783307
Sequence ACGCCTCCTGCCCTTTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183434079_1183434085 -1 Left 1183434079 22:37783285-37783307 CCCCTGCAAAGGGCAGGAGGCGT No data
Right 1183434085 22:37783307-37783329 TTTCGGGGTGCCTGTGTGATTGG No data
1183434079_1183434086 3 Left 1183434079 22:37783285-37783307 CCCCTGCAAAGGGCAGGAGGCGT No data
Right 1183434086 22:37783311-37783333 GGGGTGCCTGTGTGATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183434079 Original CRISPR ACGCCTCCTGCCCTTTGCAG GGG (reversed) Intergenic
No off target data available for this crispr