ID: 1183439194

View in Genome Browser
Species Human (GRCh38)
Location 22:37813606-37813628
Sequence GACCCAGGCGTCGCCCCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183439194_1183439199 -1 Left 1183439194 22:37813606-37813628 CCAGGTGGGGCGACGCCTGGGTC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1183439199 22:37813628-37813650 CCACCCTCAGCCTCCGCCTGGGG 0: 1
1: 0
2: 2
3: 37
4: 412
1183439194_1183439202 3 Left 1183439194 22:37813606-37813628 CCAGGTGGGGCGACGCCTGGGTC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1183439202 22:37813632-37813654 CCTCAGCCTCCGCCTGGGGAAGG 0: 1
1: 0
2: 8
3: 21
4: 363
1183439194_1183439196 -3 Left 1183439194 22:37813606-37813628 CCAGGTGGGGCGACGCCTGGGTC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1183439196 22:37813626-37813648 GTCCACCCTCAGCCTCCGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 332
1183439194_1183439197 -2 Left 1183439194 22:37813606-37813628 CCAGGTGGGGCGACGCCTGGGTC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1183439197 22:37813627-37813649 TCCACCCTCAGCCTCCGCCTGGG 0: 1
1: 0
2: 3
3: 50
4: 446
1183439194_1183439207 21 Left 1183439194 22:37813606-37813628 CCAGGTGGGGCGACGCCTGGGTC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1183439207 22:37813650-37813672 GAAGGAAGTGAGGCTTAGAGAGG 0: 2
1: 3
2: 73
3: 561
4: 2808
1183439194_1183439204 11 Left 1183439194 22:37813606-37813628 CCAGGTGGGGCGACGCCTGGGTC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1183439204 22:37813640-37813662 TCCGCCTGGGGAAGGAAGTGAGG 0: 1
1: 1
2: 2
3: 24
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183439194 Original CRISPR GACCCAGGCGTCGCCCCACC TGG (reversed) Exonic
900571802 1:3362334-3362356 CACCCAGGCGTCCTTCCACCTGG + Intronic
901685659 1:10942075-10942097 GACCCGGGCGTCGCAGCCCCCGG + Intergenic
903338908 1:22642321-22642343 GGCCCAGGCTTCCACCCACCAGG + Intergenic
903858185 1:26349485-26349507 GACCCAGGCCCCACCCCTCCAGG - Intronic
904116395 1:28164934-28164956 GACCCAGCTCTCGCCCTACCAGG - Intronic
904775115 1:32901508-32901530 GAGTCAGGCGCCGCCCCGCCCGG + Intergenic
906312300 1:44762491-44762513 GACCCAGGTGCCGCCTCAGCAGG - Intronic
911185668 1:94902012-94902034 GAGACAGGCCCCGCCCCACCTGG + Intronic
913671062 1:121097676-121097698 GGCCCCGGCGTGGCGCCACCTGG + Intergenic
919289879 1:195615736-195615758 ACTACAGGCGTCGCCCCACCAGG + Intergenic
1070590432 10:77796858-77796880 GAAGCAGGCGTCGACCCACGAGG - Intronic
1071500411 10:86199687-86199709 GACCCAGGCGTCATGCCAGCGGG - Intronic
1072810936 10:98461247-98461269 GATCCAGGCCTGGCCCCACATGG + Intronic
1074942125 10:118246188-118246210 GACCCGGGCATCGACCCACCTGG + Intergenic
1075205603 10:120445248-120445270 AAGCAAGGCATCGCCCCACCTGG + Intergenic
1076659795 10:132047948-132047970 GACACAGGCGGCGCCACAGCCGG - Intergenic
1076891709 10:133288009-133288031 GACCCTGCGGTCGCCTCACCGGG + Intronic
1077223317 11:1426892-1426914 GACCCAGGGGGCTTCCCACCAGG - Intronic
1077234086 11:1471537-1471559 GACCCAGGTGTCTCCCTCCCTGG + Intronic
1077860913 11:6179307-6179329 GAGCGAGGCATCGCCTCACCTGG + Intergenic
1078484101 11:11705982-11706004 GACCCTGGAGTCCCACCACCAGG + Intergenic
1081660632 11:44885952-44885974 GTCCCAGGCCTCACCCCACAGGG - Intronic
1083895001 11:65615589-65615611 GACCCAGGCGTTGCCAACCCAGG - Intronic
1089662338 11:119993726-119993748 CACCCAGGTGGAGCCCCACCTGG + Intergenic
1096111567 12:49031942-49031964 GACCCAGACCTCTCCCCTCCAGG - Exonic
1098086178 12:66846792-66846814 GACCCAGGTGTTTCCCCACATGG - Intergenic
1102041731 12:109805368-109805390 GACCCAGGCGTCCCCTCCCTGGG - Intronic
1113460487 13:110479005-110479027 GACACAGGCGAGGCCCCACATGG - Intronic
1118591707 14:67406870-67406892 AACCCAGGCCTCCCTCCACCTGG + Intronic
1122116037 14:99527730-99527752 GACCCAGGCAGCTTCCCACCGGG + Intronic
1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG + Intergenic
1122825719 14:104369531-104369553 GAGCCAGGCCCAGCCCCACCAGG + Intergenic
1124972046 15:34496870-34496892 AAGCCAGGCGTCGCCCCCTCGGG + Intergenic
1125844987 15:42843877-42843899 CACCCAGGCGTCCCCCACCCAGG + Intronic
1127964301 15:63912303-63912325 GACCCTGGCATCTCCCCGCCAGG + Intronic
1128416812 15:67454177-67454199 GGGCAAGGCATCGCCCCACCTGG - Intronic
1129393807 15:75233684-75233706 GTCCCAGGCAGGGCCCCACCTGG - Intergenic
1131468186 15:92672603-92672625 GACCCAGGCACTGCCCCACCTGG + Intronic
1132676571 16:1123621-1123643 GACCCAGGCCTGGCCCCAGTGGG + Intergenic
1133168415 16:3964972-3964994 CACCCAGGGGTCTCCCCATCGGG - Exonic
1141608978 16:85170652-85170674 GTCCCCGGCCTCGCACCACCAGG + Intergenic
1143060291 17:4194940-4194962 GACCCCAGCGTCGCCCCTTCGGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150137648 17:62704326-62704348 GACCCCGGCCTCGCCCCCCCGGG - Intronic
1151763812 17:76122041-76122063 GGCCCAGGCGTTCCCCCAGCAGG + Intergenic
1152234350 17:79130690-79130712 GACCCAGGCTTGTCCCCACCGGG - Intronic
1152658345 17:81530323-81530345 GAGCCAGGCCACGCCCCACTGGG - Intronic
1154194388 18:12254878-12254900 GGCCCAGGCTTGGCCCCTCCTGG + Intronic
1156313932 18:35950213-35950235 GACCCGGGCGCAGCCTCACCTGG + Intergenic
1161256267 19:3311548-3311570 GACCGAGGCATGGCCCCACTAGG + Intergenic
1161684558 19:5696424-5696446 GACCCTGGGGTCTCCCCACTGGG - Intronic
1161707522 19:5829135-5829157 GCCCCAGGCCTCTCCCCGCCGGG - Intergenic
1161803712 19:6430222-6430244 GCCCCAAGCGCAGCCCCACCGGG + Intronic
1165138893 19:33687597-33687619 GCCCCAGGCCTCTCCGCACCGGG - Intronic
1165459557 19:35936581-35936603 CTCCCAGGCCTCGCCCCACCCGG + Intronic
1166876538 19:45901388-45901410 GCCCCCGGCGCCGCCACACCTGG + Exonic
1166945545 19:46393939-46393961 GACCCAGGCATCTGCCCAGCTGG + Intergenic
1167077618 19:47258913-47258935 GACCCAGGCCTGCCCCCTCCAGG + Intronic
1168146073 19:54420687-54420709 GACCCAAGCGTCGGGCCAGCTGG - Intronic
1168294647 19:55372860-55372882 GACCCAGGCCTCTGACCACCGGG + Intergenic
925028098 2:625330-625352 GCCCCAGGCATCGCCTCTCCTGG + Intergenic
925108399 2:1312503-1312525 GACTCAGGCGGCACCCCTCCTGG - Intronic
925171759 2:1754466-1754488 CACACAGCCGTCTCCCCACCTGG + Intergenic
926858334 2:17281476-17281498 GACCCATGCATCACCCCACCTGG + Intergenic
932238897 2:70142221-70142243 GAGCCAGGCCCCGCCCTACCTGG - Intergenic
933969024 2:87455247-87455269 GACCCAGGGGTCGCCCACACAGG - Intergenic
935739080 2:106130786-106130808 GACCCAGGCATCACCTCACTGGG - Intronic
936324767 2:111495260-111495282 GACCCAGGGGTCGCCCACACAGG + Intergenic
945316600 2:208377472-208377494 CACCCAGCCGCCGCCCCATCCGG - Intronic
1170847596 20:19975211-19975233 GCCTCAGGCGGGGCCCCACCTGG - Exonic
1173595722 20:44257595-44257617 GACCCAGACACCCCCCCACCAGG + Intronic
1173599500 20:44283275-44283297 GACTCAGGCCTGGCACCACCTGG - Intergenic
1174231189 20:49046642-49046664 GGCCCTGGGGTCGCCGCACCTGG - Intronic
1175367713 20:58467201-58467223 GCCCCGGGCGTCGCCCCGGCTGG - Exonic
1175752440 20:61508691-61508713 AGCCCAGGCGCTGCCCCACCTGG + Intronic
1176159325 20:63640555-63640577 GGCCCAGGCCCCTCCCCACCAGG - Exonic
1179628499 21:42662214-42662236 GACCCGGGCGCCACCCCCCCAGG + Intronic
1179942878 21:44650982-44651004 GGTCCAGGTGGCGCCCCACCAGG + Intronic
1179985458 21:44918382-44918404 GGCCCAGGCCGGGCCCCACCAGG - Intronic
1180797178 22:18611597-18611619 GGCCCAGGCGCCTCTCCACCTGG + Exonic
1181224545 22:21383674-21383696 GGCCCAGGCGCCTCTCCACCTGG - Exonic
1181254087 22:21551139-21551161 GGCCCAGGCGCCTCTCCACCTGG + Exonic
1181636157 22:24175832-24175854 GACTCAGGTGTGGCCCCACTGGG + Intronic
1181797094 22:25318795-25318817 GACACAGGCGTCACCCCAAGGGG + Intergenic
1182231410 22:28840120-28840142 GACCCAGGCGGGGCAGCACCTGG - Intergenic
1182476748 22:30580714-30580736 GGGCCAGGCCTCGCACCACCAGG + Intronic
1183343930 22:37296528-37296550 GCCCCTGGCCTCACCCCACCAGG + Intronic
1183429618 22:37757778-37757800 GACCCAGGCTTCCCCGCAGCGGG + Exonic
1183439194 22:37813606-37813628 GACCCAGGCGTCGCCCCACCTGG - Exonic
1184037430 22:41925449-41925471 GACCCAGGAACCACCCCACCTGG - Exonic
950764687 3:15265146-15265168 GTCCCCTGCTTCGCCCCACCAGG + Intronic
956442145 3:69290805-69290827 GACCAAGACCTAGCCCCACCAGG - Intronic
956926107 3:73990889-73990911 GGGCGAGGCGTCGCCCCACCCGG + Intergenic
960947693 3:122978184-122978206 GAACCAGGCCTGGCCCCACCTGG + Intronic
963050775 3:141141278-141141300 GGGCGAGGCGTCGCCTCACCTGG - Intronic
963281694 3:143390644-143390666 GGGCGAGGCGTCGCCTCACCCGG + Intronic
973546799 4:51990352-51990374 GACTGAGGCATCGCCTCACCAGG - Intergenic
973693480 4:53466531-53466553 GGGCAAGGCGTCGCCTCACCCGG + Intronic
981338581 4:143594175-143594197 GGACCAGGCATCGCCTCACCCGG - Intronic
985640695 5:1062219-1062241 GCCCCAGTGGCCGCCCCACCTGG + Intronic
986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG + Intergenic
988727318 5:33938036-33938058 GGCCCCGGCGCCGCCCCACGCGG + Exonic
1002535998 5:179875887-179875909 GACCCAGGCGAGGCAGCACCCGG + Intronic
1003107490 6:3227563-3227585 GACCCAGACGCCGCCGGACCAGG - Exonic
1005939026 6:30547078-30547100 GTGCCTGGCTTCGCCCCACCTGG - Intronic
1006164828 6:32058082-32058104 GGCCCAGGCGCCGCCCCTCGTGG + Intronic
1007390264 6:41546556-41546578 GACCCCGGCGTCCCCGCCCCCGG - Exonic
1008877401 6:56344686-56344708 GACCCAGTCACCTCCCCACCAGG - Intronic
1011193990 6:84763928-84763950 GGCCCAGACGTCGCCCCAGCCGG + Exonic
1013163599 6:107569828-107569850 GCTCCAGGCCTCGCCCCACCTGG + Intronic
1017226499 6:152028338-152028360 GAGCGAGGCATCGCCTCACCTGG + Intronic
1018015009 6:159704319-159704341 GGGCCAGGCATCGCCTCACCTGG + Intronic
1020139900 7:5606451-5606473 AAGCCAGGCGTCGCCCCCTCCGG + Exonic
1021717048 7:23469910-23469932 GGCCCGGGCCTGGCCCCACCCGG - Intronic
1031664610 7:124468678-124468700 GGGCAAGGCGTCGCCTCACCAGG - Intergenic
1034898914 7:154895414-154895436 GACGCCGGCGTGGCCTCACCAGG + Intergenic
1035277848 7:157758604-157758626 GACCCCTGCGTCCGCCCACCCGG - Intronic
1035674001 8:1442230-1442252 GACCCAGGCATAGACCCGCCAGG + Intergenic
1039961976 8:42255152-42255174 TGCCCAGCCGTCGCCCCATCTGG + Intergenic
1043023446 8:75035870-75035892 GAGGCAGGCGCCGCCACACCTGG - Intergenic
1044842035 8:96344945-96344967 GACCCAGCCCTTGCCCCACGAGG + Intergenic
1047262507 8:123274893-123274915 GACCCAGGCCCCGCCCCTCGGGG + Intronic
1053520989 9:38779567-38779589 GGGCAAGGCGTCGCCTCACCTGG + Intergenic
1054193146 9:62003560-62003582 GGGCAAGGCGTCGCCTCACCTGG + Intergenic
1054645261 9:67585131-67585153 GGGCAAGGCGTCGCCTCACCTGG - Intergenic
1060831977 9:126722779-126722801 GGCCGAGGGGTGGCCCCACCAGG - Intergenic
1061212654 9:129202859-129202881 AACCCAGGCCGCGCCCCTCCGGG + Intergenic
1061764865 9:132875320-132875342 GACCCAGCCACCGCCCCAGCTGG + Intronic
1062048806 9:134436862-134436884 CAGCCAGGCGCCTCCCCACCGGG + Exonic
1062461874 9:136665714-136665736 GCCCCCGGCCCCGCCCCACCTGG - Intronic
1062587443 9:137255608-137255630 GCCCCGGGGGCCGCCCCACCTGG - Exonic
1185761255 X:2691259-2691281 TCCCCGGGCTTCGCCCCACCCGG + Exonic
1186810263 X:13181495-13181517 GGGCAAGGCGTCGCCTCACCTGG + Intergenic
1187154811 X:16712672-16712694 GCCCCAGGCCTCGCCCAGCCCGG + Intronic
1188461190 X:30429394-30429416 GAGCGAGGCATCGCCTCACCTGG + Intergenic
1193123481 X:77847380-77847402 GGGCGAGGCATCGCCCCACCCGG - Intronic
1195739302 X:108046435-108046457 GGCCCAGGGGTCGACCCAACTGG - Intronic