ID: 1183442744

View in Genome Browser
Species Human (GRCh38)
Location 22:37832514-37832536
Sequence GTGGGCTGGGGCCAGCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 385}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183442744_1183442753 6 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442753 22:37832543-37832565 TTTCTGATACGAGTGTCTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
1183442744_1183442756 19 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442756 22:37832556-37832578 TGTCTGGTGGCATCGGAGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1183442744_1183442755 18 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442755 22:37832555-37832577 GTGTCTGGTGGCATCGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 115
1183442744_1183442758 27 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442758 22:37832564-37832586 GGCATCGGAGCAGGGTGGACTGG 0: 1
1: 0
2: 0
3: 18
4: 181
1183442744_1183442757 22 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442757 22:37832559-37832581 CTGGTGGCATCGGAGCAGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 279
1183442744_1183442754 12 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442754 22:37832549-37832571 ATACGAGTGTCTGGTGGCATCGG 0: 1
1: 0
2: 0
3: 0
4: 48
1183442744_1183442752 3 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183442744 Original CRISPR GTGGGCTGGGGCCAGCCGCA GGG (reversed) Intronic
900118160 1:1037333-1037355 GTGGGCTGTGGCCAGGTGAAGGG - Intronic
900150827 1:1178759-1178781 GTGGGCTGTGTGCAGCCGCCTGG - Intronic
900373732 1:2343973-2343995 TGGGGCTGGGGCCAGGGGCAGGG + Intronic
900519715 1:3099705-3099727 GTAGGCTGGGGCCACCCACCAGG + Intronic
900782293 1:4626089-4626111 GGGAGCTGGGGCCAGGCGGAGGG + Intergenic
900951656 1:5861562-5861584 GAGGCCCGGGGCCAGCGGCATGG - Intergenic
902445625 1:16461974-16461996 GGGGTCTGGGGCCAGGAGCAAGG + Intergenic
902936592 1:19769186-19769208 GTGGTCTGGCGCCAGCTGCAAGG - Intronic
903071375 1:20728499-20728521 CTGGGCTGGGGCCTGCCCCAGGG + Intronic
903808817 1:26023183-26023205 GGTGGCTGAGGCCAGCCCCACGG + Exonic
904256736 1:29259336-29259358 GTGGGCTGGGACTCACCGCAGGG - Exonic
904463723 1:30695576-30695598 GTGGGCTGGTGCCAGGGCCAAGG + Intergenic
904495433 1:30883999-30884021 GTGGGCTGGGGCCAAGCTCCGGG + Intronic
904914478 1:33960090-33960112 GTGGGCTGGGGGCAGGAGCAGGG - Intronic
905272743 1:36797589-36797611 CTGGGATGGGCCCAGCCTCATGG - Exonic
906535170 1:46547511-46547533 GTGGGCTGGGACCTGGAGCAAGG - Exonic
906688714 1:47778908-47778930 GGGGGCTGGGGTCAGCTTCATGG - Intronic
910610363 1:89134520-89134542 GTAGGCTGGGACCAGGCCCATGG - Intronic
912715769 1:111982628-111982650 GTCGGCCGGGGCCAGGGGCATGG + Exonic
912724161 1:112044104-112044126 ATGGGCTGGGGCCTGCTCCAAGG - Intergenic
913962985 1:143353780-143353802 GTGGGCGGGGGCCGGGCGCGCGG + Intergenic
914032766 1:143974218-143974240 CTGGGCAGCGGCCAGCCCCAGGG - Intergenic
914057340 1:144179365-144179387 GTGGGCGGGGGCCGGGCGCGCGG + Intergenic
914121806 1:144787001-144787023 GTGGGCGGGGGCCGGGCGCGCGG - Intergenic
914386847 1:147178082-147178104 GTGGGGTGGGGGCAGCCGGAAGG - Intronic
915324723 1:155075462-155075484 CTGGGCTGGGGCCACACACACGG + Intergenic
915491347 1:156251634-156251656 GTGAGCTGGGCCCAGCAGCCAGG - Intronic
917035794 1:170745657-170745679 GTGTGCTGGGGCCCCCGGCATGG - Intergenic
918177165 1:182056789-182056811 GTTCGCTGTGGCCAGCCGCATGG - Exonic
918190964 1:182174266-182174288 GCGGTCTGGGACTAGCCGCAGGG - Intergenic
921909035 1:220528115-220528137 GTGGGCGGGCGCCAGCCGAGGGG - Intergenic
922227231 1:223655999-223656021 GTGGGCTGAGGGCAGATGCATGG + Intronic
1063603649 10:7504994-7505016 TTGTGCTGGGGCCAGCTGGAGGG - Intergenic
1066023100 10:31320912-31320934 CTGGGCTGCGGCCGGCGGCAGGG - Intronic
1067043509 10:42970920-42970942 GAGGCCTGGTGCCAGCAGCACGG - Intergenic
1067352965 10:45493691-45493713 GTGGTCTGGGGACAGCAGCATGG - Intronic
1067849131 10:49743946-49743968 TTGGGGTGGGGCCAGCAGCCTGG + Intronic
1069157948 10:65053540-65053562 GTGCGGTGGACCCAGCCGCAGGG + Intergenic
1069796200 10:71053429-71053451 GTGGGCTGGGGGCAGGGGGAAGG - Intergenic
1072766059 10:98096105-98096127 GTGGAGTGGGGTCAGCAGCATGG + Intergenic
1074078783 10:110151781-110151803 GTGGGCAGGGGCCAGAGGCGTGG - Intergenic
1075261104 10:120964411-120964433 CCGGTCTGGGGCCAGCCACATGG + Intergenic
1076117023 10:127907628-127907650 GTGCGCGGGGGCCGGCGGCAGGG + Intronic
1076653128 10:132003719-132003741 GGTGCCTGGGGCCACCCGCACGG - Intergenic
1076798650 10:132810741-132810763 GTGGGCTGGTGCCAGGGGCCCGG + Intronic
1077152439 11:1078294-1078316 GCGCGCTGGGGACAGACGCAGGG - Intergenic
1077155338 11:1088560-1088582 GTGGGCTGGGGCCATGGGCGGGG + Intergenic
1077173889 11:1180151-1180173 GTGGGCTGGGGCCGGTCGGAGGG + Intronic
1077228934 11:1450175-1450197 GCGGGGTGGGGGCAGCCGCGCGG - Intronic
1077307505 11:1874683-1874705 GTGGCCTGGGGGCTGCCGGAGGG - Intronic
1077324756 11:1958895-1958917 GTGGCCTGGGCCCAGTCCCAGGG + Intronic
1077333868 11:1994776-1994798 GGGGTCTGGGGCCAGCACCAAGG + Intergenic
1077338725 11:2016689-2016711 GTGGGGAGGGGCCAGGTGCAGGG - Intergenic
1078019353 11:7642363-7642385 GTGGGCTCCGGGCAACCGCAGGG + Exonic
1078142567 11:8702742-8702764 GTGGGCCGGGGCCAGCCAAGTGG + Intronic
1080896176 11:36450307-36450329 TTGGGCTGGGCACAGCCCCATGG + Intronic
1081596042 11:44460392-44460414 GTGGGCTGGCGTCAGCCCGAAGG + Intergenic
1081998255 11:47378099-47378121 GCGGGCTGAGGCCAGGCCCACGG - Intronic
1083212366 11:61196019-61196041 GTGGGCTGGGGGCAGATGGAGGG - Intergenic
1083303861 11:61752903-61752925 GCGGGCTGGTGCCAGCCTGAAGG - Intronic
1083750564 11:64758574-64758596 GTGGGGTGGGGCAAGCCGTGGGG - Intronic
1083944292 11:65915538-65915560 GTGGGCTGGGGCAAGGCACAGGG + Intergenic
1083967639 11:66052332-66052354 GGAAGCTGGGGCCAGCCTCAGGG - Exonic
1084066052 11:66705035-66705057 GGCGGCTTGGGCCAGCCGCTGGG + Exonic
1084143485 11:67250250-67250272 GGTCGCTGGGGCCAGCCCCAGGG - Exonic
1084720915 11:70905080-70905102 GTGGGGTGGTGCCAGGAGCAAGG + Intronic
1085329436 11:75635736-75635758 GTCGGCTTGGGCCAGCTGCATGG - Intronic
1085384650 11:76150133-76150155 GTGGGATGGAGCCAGTAGCAGGG + Intergenic
1091077466 11:132633727-132633749 GTGGGGTGGGGACAGCAGGAGGG + Intronic
1091174769 11:133547992-133548014 GTGCCCTGGGGCATGCCGCAGGG - Intergenic
1202807736 11_KI270721v1_random:14072-14094 GTGGCCTGGGCCCAGTCCCAGGG + Intergenic
1202816851 11_KI270721v1_random:49958-49980 GGGGTCTGGGGCCAGCACCAAGG + Intergenic
1202821709 11_KI270721v1_random:71871-71893 GTGGGGAGGGGCCAGGTGCAGGG - Intergenic
1091807290 12:3365817-3365839 GTGTGCAGGGGCCCGCAGCAGGG - Intergenic
1091869206 12:3873260-3873282 GTGGGAAGGGGCTAGCCGCGGGG + Exonic
1093034845 12:14323086-14323108 GTGGAATGCGGCCAGCCACAGGG - Intergenic
1096156609 12:49344988-49345010 GGGGGCGGGGGCCAGGCGGAGGG - Intergenic
1096749878 12:53751890-53751912 GGGAGCTGGAGTCAGCCGCAAGG - Intergenic
1097694712 12:62764981-62765003 ATGGGCTGGGGCCAGTCAGAAGG + Intronic
1101275597 12:103197872-103197894 GGGGGCTGGGACCAGGCCCATGG + Intergenic
1101351234 12:103931000-103931022 GAGGCCTGGGGCCAGCGGAATGG + Intronic
1101697333 12:107138972-107138994 ATGGGCTGTGGCCAGTGGCATGG - Intergenic
1101736644 12:107468250-107468272 GTGAGCTGGAGCCAGCCGGCTGG + Intronic
1101899613 12:108781694-108781716 GTGGGCAGGGCCCAGTCACAGGG - Intergenic
1103750490 12:123155765-123155787 GTGGGCTGGAGCCCTCTGCAAGG + Exonic
1103889468 12:124227929-124227951 GTGGGCAGGGGCCAGCCTTCGGG - Intronic
1104522573 12:129488761-129488783 GTGGGCAGGGGCTAGGGGCAAGG + Intronic
1104856582 12:131905055-131905077 GTGGGCTGAGGCCTGCCTCATGG + Intronic
1104918304 12:132277848-132277870 GTGGGGTGGGGCCTGGCGCAGGG - Intronic
1107414530 13:40188515-40188537 GTGGGCTTGGGGCATCTGCAGGG - Intergenic
1108052964 13:46463969-46463991 GGGGGCGGGCGCCACCCGCAAGG + Intergenic
1108630725 13:52279297-52279319 GTGGGGTGGCGCCACCAGCAGGG + Intergenic
1108655961 13:52533243-52533265 GTGGGGTGGCGCCACCAGCAGGG - Intergenic
1112011389 13:95296672-95296694 GTGATCTGGGGTCAGCAGCAGGG - Intronic
1114267500 14:21081588-21081610 GGGCTCTGGGGCCCGCCGCAGGG - Exonic
1115940874 14:38608514-38608536 GTGGGCTGCCGCCACCCCCAGGG + Intergenic
1118404842 14:65412870-65412892 GTCGGCTGGGGCCAGGCGGCGGG - Intronic
1118743906 14:68760367-68760389 GTGGGCTGGGGCCAGCCTGGTGG + Intergenic
1121010503 14:90517500-90517522 GCGGGCTGGGGGCAGGGGCAGGG - Intergenic
1121406018 14:93719858-93719880 GTGGGCTGAGGACAGGCCCAGGG - Exonic
1121845825 14:97171259-97171281 GGGGGCTGGGGTCAGACCCAGGG + Intergenic
1122235631 14:100329411-100329433 CTGGGCTGTGGCCACCCCCATGG + Exonic
1122296003 14:100706079-100706101 CCGGGCTCGGGCCAGCAGCAAGG + Intergenic
1122505156 14:102227373-102227395 GTGGGCAGAGCCCAGCAGCAGGG - Intronic
1122738683 14:103858405-103858427 GAGGGCTGGGTCCATCCCCAGGG + Intergenic
1122775083 14:104113501-104113523 AGGGGCTGGGGGCAGCAGCAGGG - Exonic
1122793203 14:104193128-104193150 GTGGGCTGGGGTCTCCCACAAGG - Intergenic
1122853345 14:104548339-104548361 CTGGGCTGGGGCCAGGGGCTGGG - Intronic
1124387241 15:29220151-29220173 GTGGGCTGGGGAGACCCGCTGGG + Intronic
1124651516 15:31477460-31477482 GTGAGGTGGGGCTAGCGGCAGGG + Exonic
1125191797 15:37002235-37002257 GGGGGCTGGAGCCAGCAGGACGG - Intronic
1125534625 15:40436173-40436195 TTGGGCAGGAGCCCGCCGCAAGG - Intergenic
1125937456 15:43649091-43649113 GTGGGGTGGGGACGGCCGGAAGG - Intronic
1125950362 15:43746508-43746530 GTGGGGTGGGGACGGCCGGAAGG - Exonic
1126802693 15:52314317-52314339 GTGGGCTGGGACCAGAAGGAAGG + Intronic
1128074264 15:64816530-64816552 GTGGGCTGTGGCCACGGGCAGGG - Intronic
1128132237 15:65236614-65236636 GTGGGCTAGGGCCAGGCCCCTGG + Intronic
1128980821 15:72184359-72184381 GTCAGCTGGGGCCAGCCGGGCGG - Intronic
1129761434 15:78131313-78131335 GTGGGCCGCTGCCAGCCGCGGGG - Exonic
1131215094 15:90529867-90529889 GTGGGGCGGGGCCGGGCGCACGG + Intergenic
1131706323 15:95000031-95000053 TTCTGCTGGGGCCAGCCTCAAGG - Intergenic
1132500596 16:283047-283069 GGGGGCCGGGGGCGGCCGCATGG + Intergenic
1132665636 16:1080248-1080270 ATGGGCTGGGGCCAGATGGAGGG - Intergenic
1132980822 16:2737989-2738011 GTGGGTTGGGGCCTGCCTTAGGG - Intergenic
1133941177 16:10310350-10310372 CTGGGCTGGGGAGAGGCGCAGGG - Intergenic
1134030786 16:10990705-10990727 ATGGGCTTGGGGCAGCCACAAGG + Intronic
1135469011 16:22712569-22712591 TTGGGCTGTGACCAGCCCCATGG - Intergenic
1136509101 16:30724838-30724860 GGAGGCTGGGGCCAGCGCCAAGG - Exonic
1136778148 16:32882362-32882384 GAGTCCTGGGGCCAGCCCCAGGG - Intergenic
1136892473 16:33979152-33979174 GAGTCCTGGGGCCAGCCCCAGGG + Intergenic
1138455171 16:57116857-57116879 GTGGGCTGGGGCCTTTCGCTGGG - Intronic
1138501511 16:57447712-57447734 GCGGGCTCGGGCGAGCCGCCTGG + Intronic
1141182435 16:81763436-81763458 TTGGGCTGGGGCCATCTCCAAGG + Intronic
1141576052 16:84964109-84964131 GAGGGGTGGGGTCAGCCTCAGGG + Intergenic
1141699496 16:85635973-85635995 AAGTGCTGGGGCCAGCAGCATGG - Intronic
1142275210 16:89114810-89114832 GTGGTCTGGAGCCAACAGCATGG - Intronic
1142290977 16:89193430-89193452 GCAGGCTGGGGCCAGGCACAGGG - Intronic
1203080567 16_KI270728v1_random:1144471-1144493 GAGTCCTGGGGCCAGCCCCAGGG - Intergenic
1142499685 17:325359-325381 GTAGGCAGGGGCCAGGGGCAGGG - Intronic
1142849573 17:2697851-2697873 CAGGGCCGGGGCCAGCTGCAGGG - Intronic
1144606273 17:16667518-16667540 GTGCGGTGGACCCAGCCGCAGGG - Intergenic
1144782582 17:17815405-17815427 GTGGGCTGGGGCCACACCTAGGG + Intronic
1144848592 17:18232814-18232836 CTTGGCTGGGGCCAGCCACCGGG + Intronic
1145013252 17:19381773-19381795 GTGCGCTGGGGCCATCTGCGGGG - Exonic
1145889849 17:28406656-28406678 GTGGGCTGAGCCCAGCTGCCTGG + Intronic
1145997317 17:29112131-29112153 GCGGGCTCGGGCCAGCAGGAAGG - Intronic
1146017098 17:29242499-29242521 TGGGGCTGGGGGCTGCCGCAAGG + Intergenic
1146269017 17:31472346-31472368 GGGGGTCGGGGCCAGCCGCAGGG + Intronic
1146571304 17:33955644-33955666 GTGGTCTGAAGCCAGCCCCACGG + Intronic
1146652673 17:34616245-34616267 GTGGGGAGGGGCCAGCAGGAGGG - Intronic
1146787588 17:35732586-35732608 CTAGGCTGGGGCCAGCCTCCTGG - Intronic
1146816948 17:35950018-35950040 GTGGGCAGAGGCCAGCAACAAGG + Intergenic
1146912160 17:36655710-36655732 GTGGGGTGGGGGCAGCTGGAAGG + Intergenic
1147047018 17:37760274-37760296 GGGGGCAGGGGCCAGCTTCACGG - Intergenic
1147596886 17:41723399-41723421 GTGGGCTGGTGACAGACACAGGG + Exonic
1147597035 17:41724152-41724174 GTGGGCTAGGGCCTCCTGCAGGG - Exonic
1147610014 17:41796328-41796350 GAGGGCTGGGGACAGCCCCCTGG - Intergenic
1147888621 17:43701461-43701483 GAGGGTTGGGGCCAGACACAGGG + Intergenic
1148081742 17:44970665-44970687 GTGAGCTGGGGCCACCGGCTTGG + Intergenic
1148359343 17:46998873-46998895 GTGGGCAGAGGCCAGCAACAAGG - Intronic
1148495113 17:48048711-48048733 GTGGGGTGGGGCCATCGGGACGG + Intronic
1148779119 17:50111810-50111832 GAGGGCTGGGGCCAGCTCCCTGG - Exonic
1150248153 17:63691285-63691307 GGGGGCTGGGGCCTGCAGGAGGG + Intronic
1150787354 17:68173860-68173882 GTGGGCAGAGGCCAGCAACATGG + Intergenic
1151758528 17:76088146-76088168 GTGGGCTGGGGGCTGCTTCAGGG - Intronic
1151947290 17:77326545-77326567 GGGGGCTGAGGCCGGCAGCACGG + Intronic
1152310918 17:79549305-79549327 GTGGGCTGGGACCAGCCAGGGGG - Intergenic
1152427744 17:80227677-80227699 GTGGTCTGGGACCAGCAGCCTGG + Intronic
1152428103 17:80229765-80229787 GTGGCCTGGGACCAGCAGCCTGG + Intronic
1152529830 17:80911293-80911315 GTGTGGTGTGGCCAGCTGCACGG + Intronic
1152554507 17:81046182-81046204 GTGGGCTGGAGCCTGCAGAACGG - Intronic
1152931280 17:83111437-83111459 GTGGGCTGGGGTCGGCCTCTGGG + Intergenic
1153457388 18:5295767-5295789 AGGGGCTGGGGCCGTCCGCAAGG - Intronic
1154197433 18:12276866-12276888 GTGGTCTTGGGCCAGCAGCAAGG + Intronic
1154209753 18:12369314-12369336 GTGGGCTGGTGACAGCCCCGGGG - Intronic
1154355095 18:13619044-13619066 GTGGGCTCTGCCCAGCTGCATGG - Intronic
1155065528 18:22265985-22266007 TGGGGCTGGTGGCAGCCGCAAGG - Intergenic
1155507860 18:26549263-26549285 GGGGCCTGGGGCCAGCCGCGCGG + Exonic
1156499050 18:37545366-37545388 GTGGGCTGGGGCCAGGCTTGGGG + Intronic
1160020695 18:75178564-75178586 TTGGGCTGGGACCAGCGGCTTGG - Intergenic
1160629279 18:80234058-80234080 GTGAGCTGTGGACACCCGCAGGG - Intronic
1160694208 19:474700-474722 GGGGGCTGTGGCCAGCCGTGGGG + Exonic
1160765186 19:804479-804501 CGGGGGTGGGCCCAGCCGCAGGG + Intronic
1160795900 19:945385-945407 GTGGGCTGGGTCAGGCAGCAGGG - Intronic
1160806038 19:992552-992574 GTGGGCTGGGGGCAGCCTCTCGG + Intronic
1160834681 19:1119163-1119185 GGGGGCTGTGTCCATCCGCAGGG - Exonic
1160837764 19:1132665-1132687 GTGGGGTGGGGAGAGCCCCAGGG - Intronic
1160942485 19:1626944-1626966 GGGGGCTGTGACCAGCCACAGGG - Intronic
1161224468 19:3136632-3136654 GTGGGCGGTGGCCAGCCGGCAGG + Intronic
1161395350 19:4042544-4042566 TGGGGATGGGGCCAGCCCCAAGG - Intergenic
1161446807 19:4323285-4323307 GTGGGATGGGGGCAGACGGAGGG - Intronic
1161707347 19:5828402-5828424 GTGGGGGGGGCCCAGCTGCAGGG + Intergenic
1161717723 19:5886316-5886338 CTGGGCTGGGGCCAGGGACAGGG + Intronic
1161724263 19:5919264-5919286 GTGGGCCCAGGCCAGGCGCAGGG - Intronic
1161837099 19:6655108-6655130 GGGGGTTGGGGCCAGGCGCTGGG + Intergenic
1162009608 19:7804324-7804346 GTGGGCTGGGGCCAAGGGCCAGG - Intergenic
1162551318 19:11359966-11359988 ATGGCCTGGGGTCAGCCCCATGG + Intronic
1163325722 19:16601904-16601926 GTGGGCGCTGGCCAGCCTCAGGG + Intronic
1163443835 19:17334977-17334999 GCGGGCGGGGACCAGCAGCAGGG - Intronic
1164627399 19:29738512-29738534 GTGGTATGGGCCCAGCCACATGG + Intergenic
1164629428 19:29752475-29752497 GAGGGCTGGGGGCAGCCTCTGGG + Intergenic
1164779539 19:30881393-30881415 GTGGGGTGGGGCCAGACATAAGG + Intergenic
1165056244 19:33177812-33177834 GTGGGCTGAAGCCAGCTGCCTGG + Intronic
1165166942 19:33863561-33863583 GTGGGTTGGGGTCACCCACAAGG - Intergenic
1165349589 19:35268777-35268799 GTGGGCTGGGGGCGGCCGCGCGG + Intergenic
1165829704 19:38724340-38724362 GTGGGCCGGGGCCATCCGTAGGG + Intronic
1166786506 19:45370403-45370425 GTGGGACGGGGGCAGCCGCAGGG - Intronic
1166881281 19:45931643-45931665 GTGGGGTGAGGCCAGACGCTTGG - Intergenic
1167225008 19:48232218-48232240 GGTGGCTGGGGACAGCAGCAGGG - Intronic
1167286454 19:48601235-48601257 GTGGGCGGGGGGCAGGGGCAGGG + Exonic
1167636559 19:50659181-50659203 GCGGGCTGGGGCCACCCACCCGG + Exonic
1167752460 19:51389106-51389128 GGGTCCTGGGGCCAGCCCCAGGG + Exonic
1167960831 19:53103188-53103210 GGGGGCAGGGACCAGCCTCAGGG + Intronic
1202696825 1_KI270712v1_random:132038-132060 GTGGGCGGGGGCCGGGCGCGCGG + Intergenic
925084695 2:1099122-1099144 GTGGGAGGAGGCCAGCCACAAGG - Intronic
925627504 2:5855852-5855874 GTGGGCAGGGTCCAACCTCAAGG + Intergenic
925959646 2:9003428-9003450 GGGGGCTGGGGCCGGGCGCCCGG - Intronic
925975195 2:9137529-9137551 CTGGGATGGGGCCAGCTGCATGG - Intergenic
927177847 2:20422745-20422767 AGGGGCAGGGGCCAGCCCCAGGG - Intergenic
927713557 2:25340118-25340140 GTGGGCAGGGCCGAGCCCCAGGG - Intronic
929574143 2:43041715-43041737 AGGGGCTTGGGCCAGCCTCAGGG - Intergenic
929775598 2:44929128-44929150 TGGGGCTGGGGACAGCGGCAGGG + Intergenic
929788741 2:45009315-45009337 GAGGGCTTGGGCCAGGCGCGCGG - Exonic
930221973 2:48754896-48754918 GTGCGCGGGTGCCAGCGGCAGGG + Intronic
932215047 2:69961145-69961167 GGTGGCTGGGGGCAGCCCCAGGG + Exonic
932570910 2:72937946-72937968 GTGGCCTGGGGGCCCCCGCAAGG - Intergenic
933779049 2:85788752-85788774 CTGGGCTGGGGCTGGCTGCAGGG + Intergenic
933816575 2:86073493-86073515 AGGTGCTGGGGCCAGCCTCAGGG - Intronic
934277980 2:91589052-91589074 GTGGGCGGGGGCCGGGCGCGCGG + Intergenic
934501266 2:94861899-94861921 GTGAGCTGGACCCAGCAGCACGG + Intergenic
934747435 2:96768843-96768865 GTGGTCCAGGGCCAGCAGCATGG - Intronic
934754501 2:96816152-96816174 GTGGGCGGGGGCGGGCCCCAGGG - Intergenic
935109676 2:100081046-100081068 GGGGGCTGGAGCCATCCACAAGG + Intronic
935305848 2:101735597-101735619 GTGGGCTGGGGCCTGCCCATGGG + Intronic
935731104 2:106065577-106065599 GTGCGCTGGGCGCAGCCGCTTGG + Intronic
936067524 2:109343644-109343666 GTGGGTTGGGGCCAGCAGGTGGG + Intronic
936125297 2:109784163-109784185 GGGGGCTGGAGCCATCCACAAGG - Intergenic
936219396 2:110587305-110587327 GGGGGCTGGAGCCATCCACAAGG + Intergenic
937801286 2:126083134-126083156 TCGGGTTGGTGCCAGCCGCAGGG - Intergenic
937986760 2:127641478-127641500 GGGGGCTGGGGCCTGCATCAGGG + Intronic
938583893 2:132670593-132670615 GTGGGCTGGACCCAGTCGCTGGG - Intronic
940533934 2:154914400-154914422 GTGGGCTGTGGCCATCAACAAGG - Intergenic
943656439 2:190513592-190513614 GTGGGCATGGGCCAGATGCATGG - Intronic
944661514 2:201925338-201925360 GTGGGTTAGGGCCACCCTCAAGG + Intergenic
945675015 2:212845709-212845731 GTAGGCTGGTGCCAGCCCGAAGG + Intergenic
946189050 2:217997769-217997791 GTGGAATGGGGCCTGGCGCATGG + Intronic
946299541 2:218814269-218814291 GTGGGCTGGGGCTAGTGACAAGG + Intronic
947722772 2:232379688-232379710 GTGAGCTGGGGCCCGCTGCTGGG + Intronic
947874588 2:233459817-233459839 GAGGCCTGGGTCCAGCCGCCAGG + Exonic
948075034 2:235159297-235159319 GAGGGCTGTGCCCAGCCACATGG + Intergenic
948334080 2:237194149-237194171 GGAGGCTGGGCCCAGCCCCATGG - Intergenic
948504774 2:238421462-238421484 TTGGGCAAGGGCCAACCGCAAGG - Intergenic
948642257 2:239383204-239383226 GTGGGCTGGAGCCAGGGTCAGGG - Intronic
948671415 2:239571057-239571079 GTGCTCTGGGGCCAGGTGCAAGG + Intergenic
948787077 2:240358365-240358387 GTGGGCTGGGCCCCTCAGCAGGG + Intergenic
948975042 2:241458858-241458880 GTGGCATGGGGCCAGCAGCATGG + Intronic
1169204708 20:3733084-3733106 GTGGGCTGGGGCCTGCTCCAGGG + Intronic
1169328723 20:4699383-4699405 GGTGGCTGGGGGCAGCCTCATGG + Exonic
1169328731 20:4699407-4699429 GGTGGCTGGGGGCAGCCTCATGG + Exonic
1169328739 20:4699431-4699453 GGTGGCTGGGGGCAGCCCCATGG + Exonic
1169328748 20:4699455-4699477 GGTGGCTGGGGACAGCCTCATGG + Exonic
1169832390 20:9838891-9838913 GGGGGCGGGGGCCAGCGGGAGGG + Exonic
1171113592 20:22505245-22505267 GTGTTCTGGGGCCAGGCACATGG + Intergenic
1171204175 20:23266338-23266360 GAGGGCTGCAGCCAGCAGCATGG - Intergenic
1172267626 20:33630461-33630483 GTGGGCTGGGGACAGGAGGAGGG - Intronic
1172765737 20:37349845-37349867 CGGGGCTGGGGCTAGACGCATGG - Intronic
1172887289 20:38239675-38239697 GTGGGCTGGGGGCAGTGGCTGGG + Exonic
1172975729 20:38904293-38904315 CTGGGCTGGGGCTGGCCTCAGGG + Intronic
1173498059 20:43533373-43533395 GTGGGCTGGTGCCAGAAGCAAGG + Exonic
1173751674 20:45481420-45481442 GTGGGCTGGAACCAGATGCAGGG - Exonic
1173834723 20:46117975-46117997 GGGTGCTGGGGCCTGCCACAGGG - Intergenic
1176045895 20:63092426-63092448 GTGGGCCGAGGACAGCCCCAGGG - Intergenic
1176124008 20:63467111-63467133 GGAGGCTGGGGCCAGCGGCCAGG - Intronic
1176138099 20:63533858-63533880 CTGGGCTGGGGGCAGCCCCCAGG - Intronic
1179886381 21:44315954-44315976 GTGTGCTGGGCCCAGCCCCGAGG + Intronic
1180107887 21:45631765-45631787 TTGGCCTGGGCCCAGCAGCATGG - Intergenic
1180142726 21:45902079-45902101 GTGCCCTGGGGCCAGCAGTAGGG + Intronic
1180955665 22:19740128-19740150 TTGGGCTGGCGCCAGGCTCATGG - Intergenic
1181821443 22:25478903-25478925 GAGGGCTGTGTCCAGCTGCAGGG + Intergenic
1182189395 22:28442952-28442974 GGGGGCTGGGGGCAGATGCAGGG + Intronic
1183177937 22:36238010-36238032 GAGGGTTGGGGGCCGCCGCATGG - Intronic
1183307099 22:37088393-37088415 TTGGGCTGTGGCCAGCCTCCAGG - Intronic
1183442744 22:37832514-37832536 GTGGGCTGGGGCCAGCCGCAGGG - Intronic
1183686448 22:39363757-39363779 ATGGGCAGGGGCCAGCTGCCTGG + Intronic
1183730868 22:39617748-39617770 GTGGGCGGGGGGCAGCAGCTAGG - Intronic
1183975153 22:41507746-41507768 GTGGCCTGGTGCTAGCTGCACGG - Intronic
1184114872 22:42416618-42416640 GGGGGCTGGGGAGAGCTGCAGGG + Intronic
1184586007 22:45448616-45448638 GTGGCCTGGGGCCAGCTGGGTGG + Intergenic
1185014043 22:48333228-48333250 GCGGGTTGGGGTAAGCCGCATGG - Intergenic
1185054116 22:48569139-48569161 GTGGGATGGGGACAGCTGCCTGG + Intronic
1185389119 22:50549335-50549357 CTGGGCTCGGGCCTGCTGCATGG - Exonic
950562673 3:13744005-13744027 CTGGGCTTGGTCCAGCCTCAGGG + Intergenic
952611668 3:35216969-35216991 CTATGCTGGGGCCAGCAGCATGG - Intergenic
952991418 3:38834317-38834339 GTTGGCCGGGGCCAGCAGCCAGG - Intergenic
953703135 3:45211969-45211991 GTGGGCTGGAGGCAGCCACAGGG - Intergenic
953705198 3:45225744-45225766 GTGCGCTGGGGCCGCCCGCGGGG - Exonic
956782817 3:72617776-72617798 GTGGGCAGGGGCCAGACCTATGG - Intergenic
957966061 3:87323426-87323448 CTGTGATGGGGCCAGCAGCAAGG + Intergenic
961202597 3:125056201-125056223 GGGGGCTGGGGCCGGGCGCCTGG + Intergenic
961456068 3:127024584-127024606 GTGGGCTGGGGTCATGGGCATGG - Intronic
961651740 3:128420399-128420421 GTGGGCTGGGGGCGCCCTCAGGG + Intergenic
961768241 3:129228941-129228963 TTAGGCCGGGGCCAGCCGCTGGG + Intergenic
962248509 3:133819571-133819593 GTGTGCTGGGGGCAGCAGAACGG - Exonic
965401457 3:168217953-168217975 GTGAGGAGGAGCCAGCCGCATGG + Intergenic
965734851 3:171809812-171809834 GGGGCCGGGGGCCAGCAGCAGGG - Intronic
967893832 3:194382014-194382036 CTGGGCCCGGGCCAGACGCAGGG + Intergenic
967893941 3:194382270-194382292 CTGGGCTGGGGCCAGATGCAGGG + Intergenic
967895715 3:194394862-194394884 CAGGGCTGAGGCCATCCGCAGGG + Exonic
967912296 3:194552458-194552480 GGGGGCTGGGGCCAGGGCCAGGG - Intergenic
967918814 3:194599258-194599280 GTGGGCTGGGGCCAGTCTATTGG + Intronic
968405382 4:336414-336436 GGGGGCTGGGGACAGCGCCAGGG - Intergenic
968426678 4:528400-528422 GAGGGCTGTGGCCAGCCTGAGGG + Intronic
968741637 4:2334416-2334438 GTGGGCTAGGGCCAGCGGCGGGG - Intronic
968935251 4:3606949-3606971 CTGGCCTGGGGCCAGGCTCAGGG + Intergenic
968954890 4:3713184-3713206 CTGGGCGGGGGCCAGCTCCAAGG - Intergenic
969259663 4:6025376-6025398 GTGGACTGGGGTCAGCCTCAGGG + Intergenic
969347936 4:6580819-6580841 GTGGGCTGAGGCCAGAGGCGAGG - Intronic
969517038 4:7653663-7653685 GTGGGCTGGGGCCTGACACCAGG - Intronic
969853053 4:9977245-9977267 GTGGGCTGGGTCTAGCCTTAGGG - Intronic
969870458 4:10101325-10101347 GAGGGCTGGGGCCAGCTGCCAGG + Intronic
970408157 4:15783257-15783279 GTGGGGTGGGGCCTGCAGGAGGG + Intronic
970535500 4:17026363-17026385 GAGGGCTGGGACCAGTCTCAAGG + Intergenic
972283063 4:37621755-37621777 CTGGGCAGGGGCCTGCCCCAGGG - Intronic
978474248 4:109108172-109108194 GTGGGGTGGGGGGAGCCGGAAGG - Intronic
979670046 4:123352128-123352150 GTGGGCATGGGGCAGACGCATGG - Intergenic
979982095 4:127269687-127269709 GTTGCCTGGGGCCAACAGCATGG + Intergenic
980322249 4:131293492-131293514 AGGGGCTGGGGCCTGCCTCATGG + Intergenic
980693605 4:136328351-136328373 GTGGGCTGCTGCCAGCTTCACGG - Intergenic
983743773 4:171168882-171168904 GTGGGATGGTGCCAGCCACAAGG - Intergenic
984715001 4:182917288-182917310 GTGGGCGGGGGCCAGCCGTGCGG - Exonic
985485248 5:145134-145156 GTGGGCTTGGCCCATCCGCTGGG + Intronic
985705968 5:1401596-1401618 GTGGGGTGGGGCCACGCACAGGG - Intronic
985915339 5:2914160-2914182 GTGAGCAGGGGCCAGGCACAGGG - Intergenic
986418324 5:7550665-7550687 GTGGACTGGGCCCAGAGGCAGGG - Intronic
986766015 5:10927268-10927290 GTGGGTTGGGGGCAGGCGGAGGG + Intergenic
988462475 5:31452557-31452579 GTGGGCTGGGTCCATCCTCCAGG - Intronic
988682254 5:33495488-33495510 ATGGGCTTGGGCCAGACCCAAGG + Intergenic
990949103 5:61278719-61278741 ATGGGCTGGGGCCAGGGGTAGGG - Intergenic
992003310 5:72455601-72455623 GTGGGGTGGGGACAGCCTCGGGG + Intronic
992771321 5:80050965-80050987 GTGGGATGGTTCCAGCCTCAGGG + Intronic
992877341 5:81069975-81069997 GTTGGCTTGGACCAGCCCCAAGG + Intronic
993904155 5:93604475-93604497 GTGGGCCGGGGCCGGCTGCGAGG + Intergenic
996329312 5:122311923-122311945 CTGGCCTGGGGGCGGCCGCAGGG + Intronic
996433038 5:123402163-123402185 CTGTGGTGGGGCCAGCGGCATGG - Intronic
996500524 5:124211213-124211235 GTGGGTTGGGGCCAAAGGCAAGG - Intergenic
996846005 5:127899668-127899690 GTGGGCTTGGGGAAGCCTCATGG + Intergenic
997724301 5:136107212-136107234 GTGGGGTGGGGCCTGAGGCAAGG + Intergenic
999262148 5:150244894-150244916 CTGGGGTGGGGGCAGGCGCAAGG - Intronic
999311106 5:150552813-150552835 GGGGGGTGGTGCCAGCAGCATGG + Intronic
1001398708 5:171434136-171434158 GTGGCCTGGGGCTGCCCGCAGGG + Intronic
1001411552 5:171515778-171515800 GAGGGCTGGGACCAGCAGCCAGG + Intergenic
1001450509 5:171820894-171820916 GTGGGCCGGGGCCAGGAGGAGGG - Intergenic
1002169514 5:177367318-177367340 TTGGGGCGGGGCCAGCCCCAAGG + Intronic
1002295692 5:178229913-178229935 GTGGACTGTGGCCAGCCCCCGGG - Intronic
1002518278 5:179775066-179775088 ATGGGCTGGGGCCAGCCCGATGG - Exonic
1002888288 6:1313828-1313850 CAGGGCTGCGGGCAGCCGCAGGG - Exonic
1003309519 6:4957304-4957326 GGGGGCTAGGGCCAGCCTCATGG + Intergenic
1004367141 6:15021993-15022015 GAGGGAGGGGGCCGGCCGCAGGG - Intergenic
1006277508 6:33017390-33017412 GTGGGCAGGGGACTGCTGCATGG + Intergenic
1006410354 6:33870128-33870150 GTGGGCTGTGGCCAGCTGCGGGG + Intergenic
1007415464 6:41688874-41688896 ATGGGCTGGGGCCAGGATCAGGG + Intronic
1007656910 6:43455936-43455958 GTGGGCTGGTGACAGGCGGAGGG - Intronic
1010046097 6:71445667-71445689 GTGAGTTGTGGCCAGGCGCAGGG - Intergenic
1014841371 6:126224456-126224478 GGGGGCTGGGACCAGGCCCATGG + Intergenic
1016407989 6:143751223-143751245 GTGGGATGGGGTCAGACTCAGGG - Intronic
1016738025 6:147501327-147501349 GAGGTCTGGGCCCAGCCTCATGG + Intergenic
1017717375 6:157222311-157222333 CTTGGCTGGGGACACCCGCAGGG - Intergenic
1017889697 6:158628133-158628155 GTGTGATGGGGCCTGCAGCAGGG + Intronic
1018023860 6:159789266-159789288 GTGGGCTGGGTCCGGCTGCGGGG + Intronic
1018452819 6:163924991-163925013 GTTGGCTGAGGCCACCTGCAAGG - Intergenic
1018920252 6:168167609-168167631 GTGCGCTGGGGGCAGGTGCAGGG + Intergenic
1019082776 6:169446363-169446385 GTGGGCAGGGGCCGGGCACAAGG + Intergenic
1019082793 6:169446407-169446429 GTGGGCAGGGGCCGGGCACAAGG + Intergenic
1019170337 6:170130153-170130175 GTGGGCTGGGGGCAGTCGGGGGG - Intergenic
1019398071 7:834154-834176 GTGGGCAGGGGCTGGCCGGATGG + Intronic
1019398086 7:834207-834229 GTGGGCAGGGGCTGGCCGGATGG + Intronic
1019528711 7:1493200-1493222 GTGGGGTGGGGGATGCCGCAGGG + Intronic
1019702829 7:2482334-2482356 CTGGGCTGGGGACAGAAGCAAGG + Intergenic
1019738662 7:2662385-2662407 GAGGGCTGGGGCCTCCAGCAGGG - Exonic
1020211935 7:6164242-6164264 GAGGGCTGGGGGCACCGGCACGG - Exonic
1021106793 7:16646545-16646567 GCGGGCGGGGGCCAGCCACGCGG + Intronic
1021295008 7:18893921-18893943 GTGGGCTTGGTCCTGCCTCAGGG - Intronic
1022524310 7:31027675-31027697 GTGGGGTGGGGCCATCAGGAAGG - Intergenic
1023773592 7:43583001-43583023 GTTGGCCGGGGCCAGAAGCAGGG + Intronic
1026980509 7:74523954-74523976 GGGGGCTGGGGCCGGCCTCGGGG + Intronic
1029448279 7:100626919-100626941 GCGGGCTGGGGCTGGCGGCAGGG + Intronic
1032448247 7:132003302-132003324 GTGGGCTGGGGTCTGCCTCCTGG - Intergenic
1033757066 7:144404048-144404070 GGGGGCTGGGCCCAGCCGTGGGG + Intronic
1036253895 8:7188641-7188663 GTGGGCTGGGTACTGCCACAGGG - Intergenic
1036363598 8:8098838-8098860 GTGGGCTGGGTACTGCCACAGGG + Intergenic
1037976619 8:23218547-23218569 GTAGTCTCGGGCCAGCCTCATGG + Intronic
1038720117 8:30027735-30027757 GGGGGCTGGGGTCAGCTGGATGG - Intergenic
1042224608 8:66505481-66505503 GTGGGCTGTGGGCGGCCGCGCGG - Exonic
1042787004 8:72559019-72559041 GAGGGCTGGGGGGAGCAGCAAGG + Intronic
1042837785 8:73093185-73093207 GAGGGCGGGGGCCGGGCGCAGGG - Exonic
1044591171 8:93916348-93916370 GCAGGCTGGGGTGAGCCGCAGGG + Intronic
1045250066 8:100475603-100475625 GTGGGGTGGGGCCAGGGGGATGG + Intergenic
1047362253 8:124179747-124179769 GTGGGGTGGTGCTAGCTGCAAGG + Intergenic
1049202498 8:141347163-141347185 AGGGGCTGGGGCCAGCTGGAGGG + Intergenic
1049291710 8:141806827-141806849 GTGGCCTGGAGCCAGGAGCAGGG + Intergenic
1049418791 8:142507670-142507692 GCTGGCTGGGGCCAGCAGCCTGG - Intronic
1049549883 8:143252348-143252370 GCGGGGTGGGGCCTTCCGCATGG - Intronic
1049746352 8:144264884-144264906 GTGGGGTGGGGCCAGCAGCCGGG - Intronic
1053430477 9:38038823-38038845 GTGGGCAGGGGCCACCCCCCAGG + Intronic
1054454933 9:65424953-65424975 CTGGCCTGGGGCCAGGCTCAGGG - Intergenic
1056752641 9:89363379-89363401 GAGGGCTGGAGCCAGGGGCAGGG - Intronic
1057197537 9:93123234-93123256 GGGCGCTGGGGCCAGCAGCTGGG - Intronic
1059423135 9:114205272-114205294 GTGGGCTGGGGGCTCCAGCAGGG - Intronic
1060274767 9:122174096-122174118 GTGGGCAGAGGCCAGAGGCATGG - Intronic
1060507161 9:124206534-124206556 GTTGGCTGAGGCCAGAAGCATGG - Intergenic
1061033574 9:128101269-128101291 GTGAGCAGGAGCCAGGCGCACGG - Intronic
1061928697 9:133821002-133821024 GTGGGCTGGGTCCAGAGGGAAGG - Intronic
1062149861 9:135012348-135012370 GTGGGCTGGGAGCAGCCGGAGGG + Intergenic
1062233234 9:135494916-135494938 GTGGGCGAGGGCCAGGCGCTGGG - Intergenic
1062270847 9:135707670-135707692 CTGGGCTTGGGCCAGACGCCAGG - Intronic
1062379692 9:136281268-136281290 GTGGGCTGGGCACAGCGGCACGG + Intergenic
1062628925 9:137454998-137455020 CTGGGCTGGGGCCAGCAGCAAGG - Intronic
1186265973 X:7834211-7834233 GTTAGCTGGGGCCAGCCTGAAGG + Intergenic
1188449542 X:30294852-30294874 GTGGGCCAGGGCCAGGCCCAGGG + Intergenic
1188684369 X:33051498-33051520 GTCGGTTGAGGCCAGGCGCAGGG - Intronic
1190254964 X:48755403-48755425 ATGGGGTGGGGCCTGCAGCAGGG - Intergenic
1196388917 X:115189774-115189796 GTGGGCTGCTGCCACCCCCACGG - Exonic
1200133389 X:153863331-153863353 GTGGGGAGGGGCCAACAGCAAGG - Intronic