ID: 1183442745

View in Genome Browser
Species Human (GRCh38)
Location 22:37832515-37832537
Sequence TGTGGGCTGGGGCCAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 387}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183442745_1183442753 5 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442753 22:37832543-37832565 TTTCTGATACGAGTGTCTGGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
1183442745_1183442756 18 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442756 22:37832556-37832578 TGTCTGGTGGCATCGGAGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1183442745_1183442758 26 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442758 22:37832564-37832586 GGCATCGGAGCAGGGTGGACTGG 0: 1
1: 0
2: 0
3: 18
4: 181
1183442745_1183442752 2 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1183442745_1183442754 11 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442754 22:37832549-37832571 ATACGAGTGTCTGGTGGCATCGG 0: 1
1: 0
2: 0
3: 0
4: 48
1183442745_1183442757 21 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442757 22:37832559-37832581 CTGGTGGCATCGGAGCAGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 279
1183442745_1183442755 17 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442755 22:37832555-37832577 GTGTCTGGTGGCATCGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183442745 Original CRISPR TGTGGGCTGGGGCCAGCCGC AGG (reversed) Intronic
900610092 1:3541050-3541072 GGCGGGGTGGGGCCAGGCGCAGG + Intronic
900623666 1:3598636-3598658 TGTGGGCTGGTGCTGGCTGCAGG - Intronic
900651318 1:3731333-3731355 TGTGGGCTGGAGCCACCCTTCGG + Intronic
900782292 1:4626088-4626110 TGGGAGCTGGGGCCAGGCGGAGG + Intergenic
900917028 1:5646319-5646341 GGTGAGCTGGGGGCAGCAGCTGG - Intergenic
901417135 1:9125106-9125128 TGTGGGATCTGGCCAGCAGCCGG - Intronic
901745902 1:11373276-11373298 TGTGGCCAGGGCCCACCCGCAGG - Intergenic
903071374 1:20728498-20728520 TCTGGGCTGGGGCCTGCCCCAGG + Intronic
903351773 1:22721193-22721215 TGTGCTCTGGGGCCAGCCTGTGG - Intronic
903502426 1:23808527-23808549 TGTGGGCTGGCTCCAGCGGCTGG - Intronic
903577036 1:24345423-24345445 TGGGGGCTGGGGGCAGAAGCTGG - Intronic
904005211 1:27360025-27360047 TGTGGGCTGGAGCCAGTGGGTGG - Intronic
904495432 1:30883998-30884020 TGTGGGCTGGGGCCAAGCTCCGG + Intronic
904914479 1:33960091-33960113 AGTGGGCTGGGGGCAGGAGCAGG - Intronic
905295970 1:36954570-36954592 CGGGGGCTGAGGCCAGCAGCAGG + Intronic
905524083 1:38623529-38623551 TGTTGGCTGGAGGCAGCTGCCGG - Intergenic
905918659 1:41704128-41704150 TGTGGACTGGGCCCAGGTGCAGG - Intronic
906033103 1:42735668-42735690 TGGGGGCTGGGTCCTGCCTCTGG + Intronic
906299904 1:44674300-44674322 TGAGGGTTGGGTCCAGGCGCGGG - Intronic
906544537 1:46611983-46612005 TGGGGGCTGGGCCCAGCTACAGG + Intronic
910292936 1:85616437-85616459 TGTGGGCGTGGGCCAGGTGCTGG - Intergenic
914747517 1:150510961-150510983 AGGGGGCTGGGGCCACCGGCTGG + Exonic
915215120 1:154335137-154335159 TGAAGGCTGGGGCTAGCCTCTGG + Intronic
916679862 1:167094287-167094309 TGATGGCTGGGACCAGCTGCTGG + Intronic
920285111 1:204873647-204873669 TGTGTGCTAGGGACAGCTGCTGG + Intronic
921909036 1:220528116-220528138 GGTGGGCGGGCGCCAGCCGAGGG - Intergenic
922756454 1:228099690-228099712 TCTGGGATGGGGCCATCAGCAGG + Intergenic
922767535 1:228163651-228163673 TGAGGGCCTGGGCCAGCAGCCGG - Intergenic
922796215 1:228341061-228341083 TGTGGGCTGCGGTCAGCCTGTGG - Intronic
1065101653 10:22336806-22336828 TGGGGGCAGGGCCCAGCCGGGGG - Intergenic
1065142972 10:22737751-22737773 TTTGGGCTGGGCCCAGCTGGAGG + Intergenic
1067834214 10:49628150-49628172 TGTGGGATGGAGCCTGCCTCTGG + Intronic
1068596200 10:58905316-58905338 TGTGGGTCCGGGCCAGCCCCTGG - Intergenic
1069557263 10:69406569-69406591 TGGGGGCTGGGGCCAGCACAGGG - Intronic
1069565643 10:69461695-69461717 GGTGGGCTGAGGCCAGCCTCTGG + Intronic
1070588021 10:77780840-77780862 AGTGCCCTGGGGCCAACCGCAGG + Intergenic
1070719624 10:78747080-78747102 CCTGGGCTGGGGGCAGCCACTGG - Intergenic
1072658236 10:97345691-97345713 TGAGGGCAGGGGCCAGATGCTGG - Intergenic
1073120821 10:101121803-101121825 TCTGGGCTGGGGGCAGCCAGCGG - Intronic
1073991574 10:109267729-109267751 TGTGGGCTGGGGCCTCTCGGTGG - Intergenic
1075396014 10:122127546-122127568 AGTGGGCTGGCCCCAGCAGCTGG + Intronic
1076370469 10:129949652-129949674 CCTGGGCTGGGGCCATCCGAGGG - Intronic
1076482207 10:130792174-130792196 TGAGGCCTGGGGCCAGCCCAGGG - Intergenic
1076519695 10:131073805-131073827 AGTGGGCTGGGGCCTGCCCGAGG - Intergenic
1077155337 11:1088559-1088581 TGTGGGCTGGGGCCATGGGCGGG + Intergenic
1077173888 11:1180150-1180172 GGTGGGCTGGGGCCGGTCGGAGG + Intronic
1077183915 11:1228173-1228195 TGTGAGCTGGGCCCCGCAGCCGG + Intronic
1077368609 11:2171327-2171349 TGGGGGCTGGGTGCAGCAGCCGG + Intronic
1077891093 11:6418865-6418887 TGGGGGATGGGGCCGGCCGGGGG + Intronic
1077915974 11:6611900-6611922 CTTGGGCTGGGTCCAGCGGCGGG - Intronic
1078672108 11:13374880-13374902 GGTGGGCTGGGGCCAGAAGGTGG - Intronic
1078920480 11:15826099-15826121 TGTTGCCTGGGGCCAGCCCTGGG - Intergenic
1081673900 11:44957252-44957274 AGAGGGCTGGGGCGCGCCGCGGG + Intergenic
1081854172 11:46293560-46293582 AGCAGGCTGGCGCCAGCCGCGGG - Intronic
1083074308 11:60020483-60020505 TGGGGGCGGGGGCCAGCCGGCGG + Intergenic
1083168403 11:60906336-60906358 TGTTGGCTGCGGCCAAGCGCGGG - Intronic
1083259284 11:61514463-61514485 TGGGGGCAGGGGCCAGCAGGTGG + Intergenic
1083310522 11:61781341-61781363 TGTGGGCTGGGGCTTGGGGCGGG + Intronic
1083326021 11:61873414-61873436 TGTGTGTTGGGGCCGGCGGCGGG - Intergenic
1083657095 11:64234872-64234894 CCTGGGCGGGGGCCAGCTGCAGG - Exonic
1083661970 11:64255620-64255642 TGTGGGGTGGGGACAGGGGCGGG + Intronic
1083696240 11:64444615-64444637 TGTGGCCCTGGGCCAGCCTCTGG - Intergenic
1083704637 11:64505592-64505614 TGAGGGCTGCTGCCAGCTGCAGG + Intergenic
1083750565 11:64758575-64758597 TGTGGGGTGGGGCAAGCCGTGGG - Intronic
1083944291 11:65915537-65915559 TGTGGGCTGGGGCAAGGCACAGG + Intergenic
1084066051 11:66705034-66705056 TGGCGGCTTGGGCCAGCCGCTGG + Exonic
1084122403 11:67077410-67077432 TGTGGGCTAGGGCCAGATACTGG - Intergenic
1084143486 11:67250251-67250273 TGGTCGCTGGGGCCAGCCCCAGG - Exonic
1084214507 11:67640084-67640106 GGCCGGCTGGGGCCAGCCTCAGG - Intergenic
1084313929 11:68332724-68332746 TGTGGGCTGAGGCCAGGCTGTGG + Intronic
1085474811 11:76783239-76783261 TGGCGGCTCGGGCCGGCCGCGGG - Intronic
1087095195 11:94311464-94311486 TGTGGGCAGGGGCAAGCTGTAGG + Intergenic
1089557200 11:119321060-119321082 TTTGGGTTGGGGCGAGCGGCCGG - Intronic
1091077465 11:132633726-132633748 TGTGGGGTGGGGACAGCAGGAGG + Intronic
1091605485 12:1948241-1948263 TGTTGGCAGGGACCAGCCTCGGG - Intronic
1091768531 12:3137273-3137295 CGTGGGCAGGGCCCAGCTGCGGG - Intronic
1091807291 12:3365818-3365840 TGTGTGCAGGGGCCCGCAGCAGG - Intergenic
1091869205 12:3873259-3873281 TGTGGGAAGGGGCTAGCCGCGGG + Exonic
1095873034 12:47051188-47051210 TGTGGGCCAGGGCCAGGCCCAGG - Intergenic
1096839521 12:54371682-54371704 AATGGACTGGGGCCAGCCCCAGG - Exonic
1100219941 12:92494018-92494040 TGTGGGCTGATGGCAGCTGCAGG - Intergenic
1100565322 12:95789838-95789860 CGTGGGCTGGGGCCGGTCTCTGG - Intronic
1101377988 12:104187592-104187614 TGTGAGGAGTGGCCAGCCGCAGG - Intergenic
1101751671 12:107587117-107587139 TGTGGGCTGGGCCCTGCACCAGG + Intronic
1102679885 12:114684206-114684228 TGTGGGCTGCGGGGAGCCGGAGG + Intergenic
1103889469 12:124227930-124227952 TGTGGGCAGGGGCCAGCCTTCGG - Intronic
1103927257 12:124429811-124429833 TGTGGGCAGCGGCCAGCAGAGGG + Intronic
1103943980 12:124516276-124516298 TGTGGCCTGGGGACTGGCGCGGG - Intronic
1103946588 12:124530804-124530826 TGTATGCTGGGGCCTGCAGCTGG - Intronic
1104784617 12:131441379-131441401 TCTGAGCTGGGGCCACCTGCAGG - Intergenic
1104870614 12:131992661-131992683 TGTGAGCTGGGGACAGCCCACGG + Intronic
1104905453 12:132211021-132211043 TGTGGACTGAGGCCGGCGGCAGG - Intronic
1104918305 12:132277849-132277871 GGTGGGGTGGGGCCTGGCGCAGG - Intronic
1105544688 13:21342805-21342827 TCTGGGCTGGGGGCAGGGGCAGG + Intergenic
1105805507 13:23949762-23949784 TCTGGGCTCAGGCAAGCCGCTGG + Intergenic
1106403103 13:29448528-29448550 TGGGGACTGGGGGCAGCTGCAGG - Intronic
1106555334 13:30804049-30804071 TGTGGGCCTGGGCCAGCCCAAGG - Intergenic
1112356094 13:98675924-98675946 TGTGAGCTTGGGCAGGCCGCTGG - Intergenic
1113413791 13:110112574-110112596 TGGGGGCTGTGGCCAGCAGAGGG - Intergenic
1113664421 13:112131497-112131519 TGTGGGCTGGAGCCTGTCCCAGG - Intergenic
1113735404 13:112674902-112674924 TGTGAGCCGGGGTCAGCGGCGGG - Intronic
1113764951 13:112875279-112875301 TGTGGGCTCGGGCTGGCTGCGGG + Intronic
1114267501 14:21081589-21081611 TGGGCTCTGGGGCCCGCCGCAGG - Exonic
1114528497 14:23380801-23380823 TGGGAGCTGGGGCCTGCAGCTGG - Intergenic
1114664280 14:24368959-24368981 TGCGTGCTGGGCCCAGCCGGGGG - Intronic
1118404843 14:65412871-65412893 GGTCGGCTGGGGCCAGGCGGCGG - Intronic
1118753283 14:68821504-68821526 TGGGTGCTGGGGCCAGGGGCAGG + Intergenic
1118776889 14:68978912-68978934 TGGGGGCTGGGGGCTGCAGCGGG + Intronic
1119682795 14:76605355-76605377 TGTGGGCAGGAGCCAGTGGCCGG + Intergenic
1121337514 14:93086364-93086386 TGAGGGCTGGGGGCAGCTCCTGG + Intronic
1121406019 14:93719859-93719881 TGTGGGCTGAGGACAGGCCCAGG - Exonic
1121445082 14:93973688-93973710 TGCGGGGAGGGGCCAGCCTCTGG - Intronic
1122076976 14:99242318-99242340 TGTGGGCTGGGTACAGCGACAGG + Intronic
1122297580 14:100713966-100713988 TCTGGGATGGGGCCAGGCTCCGG + Intergenic
1122774650 14:104111818-104111840 TGTGGGCTGGGGACAGGGGAGGG + Intronic
1122822649 14:104354990-104355012 TGGGGGCTGGGGGCAGGGGCTGG + Intergenic
1122838934 14:104445201-104445223 TGTGGGCTCAGGGCAGCCCCCGG + Intergenic
1122853346 14:104548340-104548362 GCTGGGCTGGGGCCAGGGGCTGG - Intronic
1122861944 14:104586681-104586703 TGAGGGCTGGGGGGAGCAGCGGG + Intronic
1122920392 14:104877540-104877562 TGGGGGCTGGGGCCAGCACGAGG + Intronic
1123108853 14:105855882-105855904 TGAGGGCCGGGCCCAGCCACCGG - Intergenic
1124387240 15:29220150-29220172 TGTGGGCTGGGGAGACCCGCTGG + Intronic
1124651515 15:31477459-31477481 TGTGAGGTGGGGCTAGCGGCAGG + Exonic
1125484465 15:40102726-40102748 TGTGAGCTGGGCTCAGCCGTAGG + Intronic
1126462457 15:48928062-48928084 TGGGGGCTAGGGCGAGCCGAGGG + Intronic
1128062356 15:64743057-64743079 CCTGAGCTGGTGCCAGCCGCCGG - Intronic
1128700541 15:69801095-69801117 TGGGGGCTGGGGACAGGCCCGGG + Intergenic
1129324008 15:74790110-74790132 TGGGGGATGGGGACAGCCACTGG - Intronic
1129761435 15:78131314-78131336 CGTGGGCCGCTGCCAGCCGCGGG - Exonic
1129994277 15:79991161-79991183 TATGGGCAGGAGCCAGCAGCTGG - Intergenic
1131510072 15:93044924-93044946 TGTGGGCTGGGACCGCCCACGGG - Exonic
1132317705 15:100901868-100901890 TGTGGACTGGGGCCAGTGGAGGG - Intronic
1132431618 15:101766028-101766050 TGTGGGGTGGGGAGGGCCGCCGG + Intergenic
1132869443 16:2109280-2109302 CGTGAGCTGGGCCCAGGCGCAGG - Exonic
1134052156 16:11144813-11144835 TGTGCGCTGGGGCCAGTTTCAGG + Intronic
1134717969 16:16366319-16366341 CGTGAGCTGGGCCCAGGCGCAGG + Intergenic
1134817403 16:17217152-17217174 TGTGAGCTGGGCTCAGCCTCAGG + Intronic
1134846809 16:17447307-17447329 CGTGGGCTGGGAGCAGCCCCTGG - Intronic
1134956782 16:18385840-18385862 CGTGAGCTGGGCCCAGGCGCAGG - Intergenic
1136146076 16:28317440-28317462 TGTGGGCCGGGGACTGCCCCTGG + Exonic
1136479150 16:30530879-30530901 TGTGGGCAGAGTCCAGCCACGGG - Intronic
1136560933 16:31038885-31038907 TGAGGGCTGGGGCCAGACCTGGG - Intronic
1136576762 16:31129933-31129955 CGTGGGCTGGTGCCGGCCGCTGG + Intronic
1137666470 16:50252416-50252438 TGTGGGGTGGAGGCAGCCACTGG + Intronic
1137698310 16:50477640-50477662 TGGGGGCTGGAGCCAGAGGCTGG - Intergenic
1138455172 16:57116858-57116880 AGTGGGCTGGGGCCTTTCGCTGG - Intronic
1139365153 16:66428163-66428185 TGTGGGGTGGGCCCTGCCCCTGG - Intronic
1139635354 16:68255313-68255335 TGTGGGCTGGGGCTACACACGGG + Exonic
1139851477 16:69953284-69953306 TGAAGGCTGGGGCCAGGAGCTGG - Intronic
1139880453 16:70176196-70176218 TGAAGGCTGGGGCCAGGAGCTGG - Intronic
1140037938 16:71385216-71385238 TGTGGGCAGGGGACAGCCCAGGG - Intronic
1140372057 16:74419321-74419343 TGAAGGCTGGGGCCAGGAGCTGG + Intronic
1141792127 16:86244022-86244044 TCAGGGCTGGTGCCAGCCACTGG - Intergenic
1141836857 16:86546368-86546390 GTTGGGCTGGGGCCAGAAGCGGG + Intronic
1141986504 16:87583843-87583865 TGGGGGCAGGGGGCAGTCGCAGG + Intergenic
1143457351 17:7076847-7076869 TCTGGGCTGGGGCCAGGCCAGGG - Intronic
1144569972 17:16391376-16391398 TGTTGGCTGGGCCCAGAAGCAGG - Intergenic
1144645390 17:16970284-16970306 TGTGGGCTGGGCTCAGACTCTGG + Intronic
1144672406 17:17140374-17140396 TGGGGGGTGGGGCCAGCACCAGG - Intronic
1144795678 17:17889528-17889550 AGTGGGCTTTGGCCAGCAGCTGG + Intronic
1144848591 17:18232813-18232835 ACTTGGCTGGGGCCAGCCACCGG + Intronic
1145013253 17:19381774-19381796 GGTGCGCTGGGGCCATCTGCGGG - Exonic
1145362121 17:22221162-22221184 TGTTGGCTGGGCCCAGAAGCAGG - Intergenic
1145924205 17:28633640-28633662 GGTGGGCTGGGGTCAGCTGAGGG + Exonic
1146269016 17:31472345-31472367 TGGGGGTCGGGGCCAGCCGCAGG + Intronic
1146376503 17:32298265-32298287 TGTGGGGCGGGGCAAGCCCCAGG + Intronic
1146652674 17:34616246-34616268 TGTGGGGAGGGGCCAGCAGGAGG - Intronic
1147265543 17:39232208-39232230 TGTGGGCCCAGGCCAGCCGCAGG - Intergenic
1147888620 17:43701460-43701482 TGAGGGTTGGGGCCAGACACAGG + Intergenic
1148227740 17:45910748-45910770 TGGGGGCAGGAGGCAGCCGCGGG + Intronic
1148645503 17:49217798-49217820 TCTGGCCGGGGGGCAGCCGCTGG - Exonic
1148806218 17:50265336-50265358 TCTGGGCTGGTGCCTGCCTCAGG - Intergenic
1150248152 17:63691284-63691306 TGGGGGCTGGGGCCTGCAGGAGG + Intronic
1150291505 17:63985018-63985040 TGTGGGCTGGGGTCGGCATCTGG + Intergenic
1152206555 17:78977455-78977477 CGTGGGCTGGGGGCACCCCCTGG + Intronic
1152304152 17:79511523-79511545 TGTGGGGTGAGGGCAGCAGCAGG + Intronic
1152310919 17:79549306-79549328 AGTGGGCTGGGACCAGCCAGGGG - Intergenic
1152477225 17:80526275-80526297 TGTGAGCTGGAGCCAGGCTCTGG - Intergenic
1152931279 17:83111436-83111458 GGTGGGCTGGGGTCGGCCTCTGG + Intergenic
1153967519 18:10195224-10195246 TGGGGGCTGGGACCAGCCCTCGG + Intergenic
1154209754 18:12369315-12369337 TGTGGGCTGGTGACAGCCCCGGG - Intronic
1155339850 18:24802932-24802954 TGAAGGCTGGGTCCAGCCACAGG + Intergenic
1156499049 18:37545365-37545387 GGTGGGCTGGGGCCAGGCTTGGG + Intronic
1156506537 18:37599386-37599408 TGTGGCCTGGGGCCAGGTGGAGG + Intergenic
1160037952 18:75318866-75318888 TGTGGGCTGGAGCCTGCTTCAGG + Intergenic
1160591236 18:79945721-79945743 TGGGGGCTGGAGCCAGCCTGTGG - Intronic
1160665447 19:326000-326022 GGTGGGCTGGGACCGGCCACAGG - Intronic
1160694207 19:474699-474721 GGGGGGCTGTGGCCAGCCGTGGG + Exonic
1160765185 19:804478-804500 TCGGGGGTGGGCCCAGCCGCAGG + Intronic
1160894191 19:1395086-1395108 TGAGGGCTGGGGCCGGGGGCCGG + Intronic
1160942486 19:1626945-1626967 TGGGGGCTGTGACCAGCCACAGG - Intronic
1161412375 19:4123758-4123780 AGTGGGCAGGGGTCAGCCGGAGG - Intronic
1161514675 19:4689902-4689924 CGTGGGCTGGGAGCAGCCCCTGG + Intronic
1161837098 19:6655107-6655129 CGGGGGTTGGGGCCAGGCGCTGG + Intergenic
1161864320 19:6822363-6822385 CGTGGGCGGGGGGCAGCCCCAGG + Intronic
1162088476 19:8262364-8262386 TGGGGGCTGGGGGGAGCCCCAGG + Exonic
1162386266 19:10362135-10362157 GGGGGGCTCGGGCCAGCCCCAGG - Exonic
1162736663 19:12750707-12750729 TGTGGGTGTGGGCCTGCCGCCGG + Intergenic
1163033980 19:14561199-14561221 TCTGGGCTGGGGCCATCCCAGGG - Intronic
1163325721 19:16601903-16601925 TGTGGGCGCTGGCCAGCCTCAGG + Intronic
1163443836 19:17334978-17335000 TGCGGGCGGGGACCAGCAGCAGG - Intronic
1163758741 19:19121565-19121587 GGTGGGTCTGGGCCAGCCGCAGG + Exonic
1164629427 19:29752474-29752496 AGAGGGCTGGGGGCAGCCTCTGG + Intergenic
1164713485 19:30375463-30375485 TGTGGGCTGCGGACAGGGGCCGG - Intronic
1164852957 19:31500101-31500123 TGTGGGCTGCTGCTAGGCGCTGG - Intergenic
1165075175 19:33276387-33276409 AATGGGCTGGGGCCAGGGGCAGG - Intergenic
1165300296 19:34964135-34964157 ATTGGCCTGGCGCCAGCCGCTGG + Intergenic
1165321961 19:35091053-35091075 TGTGGGCAGGGGCCAGGTGCCGG + Intergenic
1165328297 19:35126647-35126669 TCTGCGTTGGGGCCAGGCGCAGG + Exonic
1165446698 19:35860667-35860689 TGTGAGCTGGGGCCGGCCTGTGG + Exonic
1165734244 19:38165690-38165712 TCTGGGTGGGGGCCAGCAGCTGG - Intronic
1165829703 19:38724339-38724361 GGTGGGCCGGGGCCATCCGTAGG + Exonic
1165893613 19:39128933-39128955 TCTGGGCTGGGGCTGGCCTCAGG + Intronic
1166717419 19:44977429-44977451 TGTGGACTGTGGCAAGCCGGCGG - Exonic
1166786507 19:45370404-45370426 GGTGGGACGGGGGCAGCCGCAGG - Intronic
1166976362 19:46607350-46607372 TGTGGGCTGGGGTGAGGCGGTGG - Intronic
1167225009 19:48232219-48232241 TGGTGGCTGGGGACAGCAGCAGG - Intronic
1167374005 19:49101743-49101765 GGGGGGCTGGGGCCAGCTGGAGG + Intronic
1167556908 19:50202554-50202576 TGTGGGCTCAGGCCAGTTGCTGG - Intronic
1167577665 19:50325550-50325572 GGTGGGCTGGGGGCCGGCGCAGG + Intronic
925196092 2:1927085-1927107 TGTGAGCGGGGGCCAGCCTGGGG + Intronic
925738037 2:6981086-6981108 TGTGGGCCAGGGCCAGGCCCAGG - Intronic
926739815 2:16101988-16102010 TGTGGGGTGGGTGCAGCCCCAGG - Intergenic
927055081 2:19359618-19359640 ATTGGGCTGGGGTCAGCCGGAGG - Intergenic
927177848 2:20422746-20422768 TAGGGGCAGGGGCCAGCCCCAGG - Intergenic
928313719 2:30231064-30231086 GGTGGGCTGGGGACAGCCAGTGG + Intergenic
930089859 2:47523865-47523887 AGTGGGGTGGGGCCAGCCCTGGG + Intronic
932564679 2:72898426-72898448 TGTGGGCTGAGGGAGGCCGCTGG - Intergenic
935305847 2:101735596-101735618 GGTGGGCTGGGGCCTGCCCATGG + Intronic
936067523 2:109343643-109343665 GGTGGGTTGGGGCCAGCAGGTGG + Intronic
936561235 2:113541594-113541616 TGGAGGCTGCGGCCAGGCGCGGG + Intergenic
937252743 2:120534649-120534671 ACTGGGCTGGGGTCAGCCGAGGG + Intergenic
937317902 2:120943680-120943702 TGGTGGCTGGGGCCAGACACAGG - Intronic
937986759 2:127641477-127641499 TGGGGGCTGGGGCCTGCATCAGG + Intronic
938236901 2:129712618-129712640 TGTGGCCTTGGGCCAGCCTCTGG - Intergenic
938406804 2:131037333-131037355 TGAGGGCTGGGGCTGGCCACTGG - Intronic
938583894 2:132670594-132670616 TGTGGGCTGGACCCAGTCGCTGG - Intronic
942496675 2:176547406-176547428 AGGGGGCTAGGGCCAGCCCCAGG + Intergenic
942532423 2:176925550-176925572 TGTGTGCTGAGGCCAGCAGCTGG - Intergenic
942654555 2:178201477-178201499 AGGGGGCTGAGGCCAGCAGCTGG - Intronic
944326412 2:198410326-198410348 TGTGGGGTGGGGCCAACCTCGGG - Intronic
944801132 2:203238958-203238980 TGTGGGCGGGGGCACCCCGCGGG - Exonic
946251976 2:218419402-218419424 AGTGGGATGGGGCTAGCCACAGG - Intronic
946836733 2:223780128-223780150 TGTAGGCTGGGGCCAGGGGGTGG - Intronic
947722771 2:232379687-232379709 GGTGAGCTGGGGCCCGCTGCTGG + Exonic
947728910 2:232417481-232417503 TGAGTGCTGGGTCCAGCCGCAGG - Intergenic
947800970 2:232928300-232928322 TGCGGGCTGGGGCCTGCCGCGGG + Intronic
948386151 2:237582265-237582287 TGTGGGGTGGGGCCCACAGCAGG - Intronic
948642258 2:239383205-239383227 TGTGGGCTGGAGCCAGGGTCAGG - Intronic
948893840 2:240919197-240919219 TGGGGGGTGAGGCCAGCCCCAGG - Intronic
1169197121 20:3689299-3689321 TGTGGTCTGGAGCCAGCCTGTGG - Intronic
1169204707 20:3733083-3733105 TGTGGGCTGGGGCCTGCTCCAGG + Intronic
1170629198 20:18053925-18053947 TGTGGGCTGAGTCCCGCAGCTGG - Intronic
1171494921 20:25548799-25548821 TGGGTGCTGGGGCCAGCCTTGGG - Intronic
1171495090 20:25549299-25549321 TGTGTGCTGGGGTCAGCCCTGGG - Intronic
1172198555 20:33109045-33109067 TGTGGGCAGGGGTCAGATGCTGG + Intronic
1172268788 20:33640549-33640571 TGGGGGCTGGGGTGAGCAGCTGG + Intronic
1172273384 20:33667060-33667082 TTCGGGCTCGGCCCAGCCGCGGG - Exonic
1172640217 20:36436251-36436273 TGAGGGCTTGGGGCTGCCGCCGG - Exonic
1172887288 20:38239674-38239696 AGTGGGCTGGGGGCAGTGGCTGG + Exonic
1173247153 20:41344756-41344778 AGTGGGCTGAGGCCAGCCCAAGG + Intronic
1173292397 20:41726393-41726415 TGTATGCTGGGGCCACCAGCTGG - Intergenic
1173834724 20:46117976-46117998 TGGGTGCTGGGGCCTGCCACAGG - Intergenic
1175165601 20:57041744-57041766 GGTTGGCTGGGGCCTGCCCCGGG - Intergenic
1175852585 20:62101774-62101796 TCTGGGCTGGGGCCAGGGGTAGG - Intergenic
1176088463 20:63308580-63308602 TCTGGACGGAGGCCAGCCGCCGG - Exonic
1176256666 20:64156614-64156636 TGAGGGCTGGGGGCACCGGCAGG - Intronic
1180046492 21:45308693-45308715 TGTAGGCTGGGGCCTCCGGCGGG + Intergenic
1180142725 21:45902078-45902100 TGTGCCCTGGGGCCAGCAGTAGG + Intronic
1180201914 21:46229287-46229309 TGTGAGGAGGGTCCAGCCGCGGG + Intergenic
1181051025 22:20238324-20238346 TGTGAGCTGGGGCCCGGGGCGGG - Intergenic
1181100776 22:20537411-20537433 TGAGGTCTGGGGCCAGAGGCTGG - Intronic
1181609210 22:24001393-24001415 TGTGGCCTGGGCCCAACTGCTGG + Intergenic
1181821442 22:25478902-25478924 TGAGGGCTGTGTCCAGCTGCAGG + Intergenic
1182189394 22:28442951-28442973 TGGGGGCTGGGGGCAGATGCAGG + Intronic
1183307445 22:37090137-37090159 TGTGGGCTGGGGGCATCCTGGGG + Intronic
1183316089 22:37137595-37137617 TGTGGCCTGGGGACAGCGTCCGG + Exonic
1183442745 22:37832515-37832537 TGTGGGCTGGGGCCAGCCGCAGG - Intronic
1183706843 22:39479467-39479489 TGTGGGGAGGGGCCAGGGGCTGG - Intronic
1183831314 22:40419637-40419659 TGGGGGCTGGGGACAGCTGTGGG - Intronic
1184101725 22:42344468-42344490 TGGGGACTGAGGCCAGCTGCGGG - Intergenic
1184266069 22:43346701-43346723 TGAGGACTGGGGTCGGCCGCTGG - Intergenic
1184421561 22:44385417-44385439 TGGGGGCTGGGCTCAGCCGAGGG - Intergenic
1184864074 22:47192831-47192853 TGGGGGGTGCGGACAGCCGCTGG - Intergenic
1185014510 22:48335200-48335222 TGTGGGCTCTGGGCGGCCGCCGG + Intergenic
1185274866 22:49946143-49946165 TCTGCGCTGGGGCCAGGCGGCGG + Intergenic
951325484 3:21297250-21297272 TGGTGGCGGGGGCCACCCGCTGG + Intergenic
953703136 3:45211970-45211992 CGTGGGCTGGAGGCAGCCACAGG - Intergenic
953705199 3:45225745-45225767 CGTGCGCTGGGGCCGCCCGCGGG - Exonic
953903799 3:46858185-46858207 TGTGGGCAGGTGGCAGCAGCGGG + Exonic
954715382 3:52524244-52524266 TGTGGGATGGGCCCAGGCCCTGG + Intronic
956229552 3:66998419-66998441 GGTGGGCCGGGGCCGGCCACAGG + Intronic
956956615 3:74348645-74348667 TGGGGGCTGGAGACAGCAGCTGG - Intronic
957822876 3:85400975-85400997 TGTGGGTTGGAGGCAGCAGCCGG - Intronic
960939333 3:122923181-122923203 TGTGGTCAGGGCCCAGCCGTGGG - Intronic
961365626 3:126397760-126397782 TGTGTCCTGGGGTCAGCTGCAGG + Intronic
961458485 3:127035963-127035985 AGTGGGCTGGGGGCAGGGGCTGG - Exonic
961513798 3:127420463-127420485 TGTGGCCAGGGTCCAGCTGCTGG + Intergenic
961768240 3:129228940-129228962 CTTAGGCCGGGGCCAGCCGCTGG + Intergenic
962770739 3:138608564-138608586 TGTGGGTAGGAGCCGGCCGCTGG - Intergenic
964433601 3:156630089-156630111 TGTGGACTGGGGTCAGCTGAGGG - Intergenic
966372882 3:179266807-179266829 TGGGGGCTGGGGGCTCCCGCTGG - Intronic
967633147 3:191770619-191770641 TGTGGGGTGGGGTCAGCAGCCGG - Intergenic
967893940 3:194382269-194382291 CCTGGGCTGGGGCCAGATGCAGG + Intergenic
968323330 3:197791120-197791142 TGTGGGCGGGGGCAAGCGCCTGG + Intergenic
968405383 4:336415-336437 TGGGGGCTGGGGACAGCGCCAGG - Intergenic
968426677 4:528399-528421 TGAGGGCTGTGGCCAGCCTGAGG + Intronic
968480803 4:832256-832278 TGTGGGCTGAGGCCTGGGGCGGG + Intergenic
968483987 4:849979-850001 TGTGGGACGGGGAGAGCCGCTGG - Exonic
968524721 4:1050270-1050292 TGGAGGCTGGGCCCAGCAGCTGG + Intergenic
968594082 4:1473418-1473440 TCTGGGCGGGAGCCAGCCACAGG + Intergenic
968741638 4:2334417-2334439 AGTGGGCTAGGGCCAGCGGCGGG - Intronic
969259662 4:6025375-6025397 TGTGGACTGGGGTCAGCCTCAGG + Intergenic
969486612 4:7475768-7475790 TGTGGTCTGGGGCCTGGCCCAGG + Intronic
969853054 4:9977246-9977268 TGTGGGCTGGGTCTAGCCTTAGG - Intronic
975706094 4:77113244-77113266 CCTGGGCTGGGGCCGGCTGCAGG + Intergenic
981941651 4:150287694-150287716 TGTAGGCTAGGTCCAGCAGCTGG - Intronic
983070048 4:163257140-163257162 TGTGAGGTGTGGCCAGCAGCAGG - Intergenic
985248142 4:187996941-187996963 TGGGGGCTGGGGCGAGGCCCAGG - Intronic
985485247 5:145133-145155 GGTGGGCTTGGCCCATCCGCTGG + Intronic
985642122 5:1068577-1068599 CGAGGGCTGGAGCCAGCCGCAGG - Intronic
985661891 5:1161493-1161515 TGTGGGCTGGGCCCTCCCTCTGG + Intergenic
985999508 5:3619548-3619570 TCTGGGCTGATGCCAGCTGCGGG - Intergenic
986766014 5:10927267-10927289 TGTGGGTTGGGGGCAGGCGGAGG + Intergenic
987090231 5:14503668-14503690 TGTGGGCCAGAGCCAGCCCCAGG + Intronic
992003309 5:72455600-72455622 TGTGGGGTGGGGACAGCCTCGGG + Intronic
992484316 5:77180545-77180567 TCTGGGCTTGTGCCAGCGGCCGG - Intergenic
993415467 5:87624506-87624528 TGTGGGCTGGGGCTGGGAGCTGG - Intergenic
997512808 5:134465180-134465202 TATGGGCAGGGGCCAGCCAGTGG + Intergenic
1000712788 5:164601374-164601396 TGTGGACCTGGGCCAGCTGCTGG - Intergenic
1001450510 5:171820895-171820917 TGTGGGCCGGGGCCAGGAGGAGG - Intergenic
1001837378 5:174843678-174843700 TGAGGGCTGGGGCCCTCCGAAGG + Intergenic
1002106522 5:176881920-176881942 TGTGGGCTGGGCCCAGGCAGTGG - Intronic
1002295693 5:178229914-178229936 AGTGGACTGTGGCCAGCCCCCGG - Intronic
1002304238 5:178273953-178273975 TGTGGGCAGGGTCCATCCCCTGG - Intronic
1002445164 5:179286260-179286282 TGTGGGCAGGTGCCAGCCCAGGG - Intronic
1003406932 6:5833747-5833769 TCTGGGCTGGGGACAGGGGCAGG - Intergenic
1004148563 6:13092506-13092528 TGTGGACTGGGGACAGCAGGTGG + Intronic
1004496058 6:16164326-16164348 TGTAGGCTGGGTCTAGCCACTGG - Intergenic
1004684317 6:17927905-17927927 TGTCTGCTGGTGCCAGCCTCTGG - Intronic
1006410353 6:33870127-33870149 GGTGGGCTGTGGCCAGCTGCGGG + Intergenic
1006463239 6:34176363-34176385 TTTGGGCTGGGACCTGCCGGGGG - Intergenic
1007116342 6:39345742-39345764 TGTGGACTGGGGCAAGGCGAGGG + Exonic
1007459526 6:42007962-42007984 TGAAGGCTGGGGACAGCAGCTGG + Intronic
1007902596 6:45424153-45424175 TGAGGGCGGGTGGCAGCCGCGGG + Intronic
1010046098 6:71445668-71445690 TGTGAGTTGTGGCCAGGCGCAGG - Intergenic
1017908338 6:158772004-158772026 TGTGGGTTGGGCCCAGGCCCTGG - Intronic
1017983445 6:159422376-159422398 TGGGGGCTGGGGGCCGCGGCTGG + Intergenic
1018023859 6:159789265-159789287 GGTGGGCTGGGTCCGGCTGCGGG + Intronic
1018872940 6:167796848-167796870 TGTGGGCTGGGGCGGGCAGCAGG - Exonic
1019009988 6:168837118-168837140 TGTGGGTTAGGGCCAGACTCTGG + Intergenic
1019128064 6:169854427-169854449 TGTGGGCTGGTCCCAGCACCAGG - Intergenic
1019166876 6:170103007-170103029 TGTGGGCAGAGGCCAGACGTGGG - Intergenic
1019170338 6:170130154-170130176 GGTGGGCTGGGGGCAGTCGGGGG - Intergenic
1019360631 7:602578-602600 TGCCGGCTGGGGCCTGGCGCTGG + Intronic
1019740411 7:2670240-2670262 AGTGGGCTGGGTGCAGCCACGGG + Intergenic
1020714227 7:11649531-11649553 AGTGTGCAGGGGCCAGCAGCTGG + Intronic
1021295009 7:18893922-18893944 TGTGGGCTTGGTCCTGCCTCAGG - Intronic
1021886425 7:25144377-25144399 TGAGGCCAGGGGCCAGCGGCTGG - Intronic
1022465322 7:30649436-30649458 AGGGGGCTGGGGGCAGGCGCAGG + Intergenic
1022529519 7:31058123-31058145 TGTGGGCCTGGGCCAGACGCTGG + Intronic
1025220012 7:57099440-57099462 TGTATGCTGGTGCCAGCCGGGGG + Intergenic
1025630792 7:63271021-63271043 TGTATGCTGGTGCCAGCCGGGGG + Intergenic
1026980508 7:74523953-74523975 TGGGGGCTGGGGCCGGCCTCGGG + Intronic
1026991307 7:74587535-74587557 TGTGGGGTGGAGCTAGACGCAGG - Intronic
1027333273 7:77122030-77122052 TGTGGGCTGGCGCTGGGCGCTGG - Intergenic
1029782517 7:102749272-102749294 TGTGGGCTGGCGCTGGGCGCTGG + Exonic
1030427716 7:109400647-109400669 TGTGGGCTGGGGCTTGCCTGAGG - Intergenic
1031524388 7:122807161-122807183 TGTGGGTTGGGGCATACCGCTGG - Intronic
1032260389 7:130331420-130331442 TGTGGACTTGGTCCAGCTGCAGG - Intergenic
1033149637 7:138902293-138902315 TGTGGGTTGGGGGCAGGAGCCGG - Intronic
1033757065 7:144404047-144404069 GGGGGGCTGGGCCCAGCCGTGGG + Intronic
1034610899 7:152367375-152367397 TGTATGCTGGTGCCAGCCGGGGG - Intronic
1035205206 7:157290290-157290312 GGGGGGCTGGGGCCACCCCCAGG + Intergenic
1035268843 7:157708056-157708078 GGGCCGCTGGGGCCAGCCGCTGG + Intronic
1035400834 7:158564583-158564605 TGGGGGCTGGGGCCAGGGCCTGG - Intronic
1035626693 8:1076288-1076310 TGTGAGCTGCGGACAGCCGGCGG - Intergenic
1038635950 8:29287265-29287287 TGGGGGTTGGGCCCAGGCGCTGG + Intergenic
1039454478 8:37697942-37697964 TGGGGGCCTGGGCCTGCCGCCGG + Exonic
1039470075 8:37807985-37808007 TGTGGGCTCTGGGCAGCCGCAGG - Intronic
1040073281 8:43205279-43205301 TGTCAGCTGGGGCCATCCGATGG - Intergenic
1042021034 8:64371328-64371350 TGCGCACTGGGGCCCGCCGCTGG - Intergenic
1042229616 8:66542625-66542647 TGCGGGCCAGGGCCATCCGCAGG + Intergenic
1046525626 8:115378834-115378856 TGTGGGCTGGACCCAGGGGCAGG - Intergenic
1047998551 8:130358490-130358512 TCTGGGCTCCGGCCGGCCGCTGG + Intronic
1048874896 8:138828939-138828961 TGGGGGCTGGGGGCTGCCTCAGG + Intronic
1049219157 8:141420996-141421018 GGTGGGCAGGGGCCAGGCTCAGG + Intronic
1049240537 8:141535517-141535539 TGTGGGGTCAGGCCAGCCACGGG - Intergenic
1049692734 8:143969719-143969741 TGGGGAGTGGGGCCAGCCGGGGG + Intronic
1049746353 8:144264885-144264907 GGTGGGGTGGGGCCAGCAGCCGG - Intronic
1049757642 8:144317884-144317906 TGGGGGCTGGGGGCAGCCACTGG - Intronic
1053624322 9:39853252-39853274 AGAGGGCTGGGGTCATCCGCGGG - Intergenic
1053732879 9:41074819-41074841 TGAAGGCTGGGGCCAGGCGCGGG - Intergenic
1053880547 9:42589975-42589997 AGAGGGCTGGGGTCATCCGCGGG + Intergenic
1054094535 9:60887772-60887794 GGAGGGCTGGGGTCATCCGCGGG - Intergenic
1054219574 9:62397445-62397467 AGAGGGCTGGGGTCATCCGCGGG + Intergenic
1054231140 9:62511728-62511750 AGAGGGCTGGGGTCATCCGCGGG - Intergenic
1054695550 9:68356735-68356757 TGAAGGCTGGGGCCAGGCGCGGG + Intronic
1055180516 9:73380677-73380699 TGTGGGCTGGGCCCAGGGCCCGG - Intergenic
1056690585 9:88805365-88805387 TGAGGGCTGGAGTCAGCTGCAGG + Intergenic
1057197538 9:93123235-93123257 GGGGCGCTGGGGCCAGCAGCTGG - Intronic
1057199662 9:93133484-93133506 TGTGGGCAGGGGGCAGGCCCTGG - Intronic
1057229271 9:93308993-93309015 TGTGAGCTATGGCCAGACGCTGG - Intronic
1057312648 9:93951756-93951778 TGTGGCCTGAGCCCAACCGCTGG + Exonic
1057617272 9:96602878-96602900 TGTGGGCTGGGGAGAGACGCAGG + Intronic
1058483962 9:105424423-105424445 TGTGGGCTGGGGCGAGGAGTGGG + Intronic
1059381667 9:113932003-113932025 TGTGGGCTGGGGCCTGTTGTGGG + Intronic
1060102308 9:120851376-120851398 TGGAGGCTGGAGGCAGCCGCTGG - Intergenic
1060211222 9:121711769-121711791 TGTGGGATGGGGCCTGGCTCTGG + Intronic
1060234428 9:121852554-121852576 TGGGGGGTGGGGCCAGACGATGG + Intronic
1061001914 9:127907401-127907423 GCTGGGCTGGGGCCACCAGCAGG + Intergenic
1061326706 9:129868709-129868731 TGTGTGCTGGGGCCAGGAGTGGG + Intronic
1061456014 9:130698287-130698309 AGTGGGCTGGGGGGAGCCGTGGG + Intronic
1061780742 9:132994787-132994809 TGTGGGGTGGCGCCAGCGGAAGG + Intergenic
1061920368 9:133779242-133779264 TGTGGCCTTGGGCAAGCTGCTGG - Intronic
1062090929 9:134678492-134678514 TGTTGGCTGGTGCCAGCCCCGGG + Intronic
1062149860 9:135012347-135012369 GGTGGGCTGGGAGCAGCCGGAGG + Intergenic
1062233235 9:135494917-135494939 TGTGGGCGAGGGCCAGGCGCTGG - Intergenic
1062504307 9:136865602-136865624 TGGGGACTGGGGCAAGCAGCAGG - Intronic
1062549438 9:137079178-137079200 TGAGGGGCGGGGCCAGCCTCGGG - Intronic
1185458011 X:320035-320057 TGGGGGTTGGGTCCAGCCCCAGG + Intergenic
1188449541 X:30294851-30294873 TGTGGGCCAGGGCCAGGCCCAGG + Intergenic
1189299676 X:39943479-39943501 TGGGGGCTGGGGCCATCCAAAGG - Intergenic
1190254965 X:48755404-48755426 TATGGGGTGGGGCCTGCAGCAGG - Intergenic
1190333827 X:49251102-49251124 TGGGGGCTGGGGCCAGGACCGGG + Exonic
1190750547 X:53358069-53358091 TGTGGCCTTGAGCCAGCTGCTGG + Intergenic
1191178724 X:57536774-57536796 TGGGGGTTGGGGCCAGCTGCAGG + Intergenic
1191714172 X:64182695-64182717 TCTGGCCTGAGGCCAGCTGCTGG + Intergenic
1197267214 X:124387837-124387859 TGTAGGCTGTGGCAAGCTGCAGG - Intronic
1198276141 X:135097724-135097746 AGTGGGCTGGGGGCGGCCCCGGG - Intergenic
1200092840 X:153643900-153643922 TGGGGGCTGGGGCCAGCCTGGGG + Intronic