ID: 1183442752

View in Genome Browser
Species Human (GRCh38)
Location 22:37832540-37832562
Sequence CTCTTTCTGATACGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183442747_1183442752 -10 Left 1183442747 22:37832527-37832549 CCCAGCCCACAGCCTCTTTCTGA 0: 1
1: 0
2: 8
3: 38
4: 445
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1183442745_1183442752 2 Left 1183442745 22:37832515-37832537 CCTGCGGCTGGCCCCAGCCCACA 0: 1
1: 0
2: 1
3: 42
4: 387
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1183442746_1183442752 -9 Left 1183442746 22:37832526-37832548 CCCCAGCCCACAGCCTCTTTCTG 0: 1
1: 1
2: 4
3: 101
4: 777
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1183442743_1183442752 4 Left 1183442743 22:37832513-37832535 CCCCTGCGGCTGGCCCCAGCCCA 0: 1
1: 0
2: 8
3: 119
4: 1006
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1183442744_1183442752 3 Left 1183442744 22:37832514-37832536 CCCTGCGGCTGGCCCCAGCCCAC 0: 1
1: 0
2: 1
3: 36
4: 385
Right 1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183442752 Original CRISPR CTCTTTCTGATACGAGTGTC TGG Intronic
900743542 1:4344801-4344823 CTCCTTCAGATACCAGTGGCAGG + Intergenic
904883234 1:33716211-33716233 CTCCTTCTGCTACCAGTCTCTGG - Intronic
910574687 1:88747528-88747550 ATCTTTCTCAAACGAGTGTCAGG - Intronic
910986653 1:93011620-93011642 CTCGGTCTGATGCAAGTGTCAGG - Intergenic
911624941 1:100112988-100113010 CACTTTCTGATAGGATTGTTAGG - Intronic
911718202 1:101159794-101159816 CTCTTTTTGATACGGTTGTTTGG + Intergenic
912531440 1:110326398-110326420 CTCTTGCTGTTTCTAGTGTCTGG - Intergenic
915766773 1:158371250-158371272 CTCTTTCTGTTACCAGAGACTGG + Intergenic
916533509 1:165680864-165680886 CTCTTTCTGTTCCCAGTTTCGGG - Intronic
920714824 1:208330000-208330022 CTCCAACTGATAAGAGTGTCAGG - Intergenic
1065880416 10:30032788-30032810 CTGTTTGTGCTACAAGTGTCAGG - Intronic
1067085520 10:43236009-43236031 CTCTTTCTCATTGGGGTGTCAGG - Intronic
1070235011 10:74615137-74615159 CTCTTTCTCATACAAGGGTATGG - Intronic
1071803283 10:89088588-89088610 CTCTTTGGGATACCAGTCTCTGG + Intergenic
1073730833 10:106285721-106285743 CTCTCTCTGCTCCCAGTGTCTGG - Intergenic
1089711436 11:120317635-120317657 CTCTTTCTGACATGAGTGTTTGG - Intronic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1093670058 12:21862891-21862913 CTCTTTCTGACTCGTGTGTTTGG - Intronic
1098540862 12:71655682-71655704 ATCTTGCTGATAAAAGTGTCTGG - Intronic
1101594351 12:106150822-106150844 CTCTGTCTGCTATGAGTGGCTGG - Intergenic
1105421512 13:20256451-20256473 CTCTTCCTGATATAAATGTCTGG + Intergenic
1112959414 13:105105184-105105206 CTCTTTCTGATGCAAGTACCAGG + Intergenic
1118783973 14:69030157-69030179 CTTTTTCTGATTTGGGTGTCAGG - Intergenic
1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG + Intronic
1127754846 15:62082019-62082041 CCTTTTCTGGTACCAGTGTCAGG - Intergenic
1128776886 15:70327369-70327391 CTCTTTCAGTTACAAGTGGCAGG + Intergenic
1129882285 15:79015403-79015425 CTCTCTCTGATTCCAGTGTGTGG - Exonic
1131806774 15:96130705-96130727 CACGTTCTGATACTACTGTCTGG - Intergenic
1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG + Intronic
1133394376 16:5434277-5434299 CTCCCTCTGATGCGTGTGTCTGG - Intergenic
1133898001 16:9947718-9947740 CTCTTTCTCTTACTGGTGTCTGG + Intronic
1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG + Intronic
1138313920 16:56052070-56052092 CTCTTTCTAAAAAGAGTGACCGG + Intergenic
1140632353 16:76868858-76868880 CTATTACTGTTAGGAGTGTCTGG + Intergenic
1148621603 17:49038656-49038678 CTCTTGCTAATACGAGTGTGTGG - Intronic
1154108457 18:11545806-11545828 CTGTTTCTGGTCCAAGTGTCTGG - Intergenic
1154470479 18:14695243-14695265 CTCTATCTGATGAGAGTTTCAGG + Intergenic
1159049264 18:63402849-63402871 CTCTATACGATACGACTGTCTGG + Intronic
926262551 2:11279855-11279877 ATCTTTCTGTTACCAGTTTCTGG - Intronic
931057923 2:58493612-58493634 CAGTATCTGATATGAGTGTCTGG - Intergenic
935139315 2:100338683-100338705 CTCTTTCTGGGATGTGTGTCTGG + Intergenic
937921294 2:127133462-127133484 CTCTTTCTGATGGGACTGTGGGG - Intergenic
944338075 2:198561513-198561535 CTATTTCTGTCAAGAGTGTCTGG - Intronic
1169564762 20:6841752-6841774 TTCTTTCTGATCCAAGAGTCAGG + Intergenic
1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG + Intergenic
1172228710 20:33322729-33322751 CTCTTTCTGATAAAGGTCTCTGG - Intergenic
1172925853 20:38534372-38534394 CTCTTTCTGATAGGATCGACAGG + Intronic
1173408614 20:42789653-42789675 CTATTTCTGAAAGGAGTTTCAGG + Intronic
1176804006 21:13462624-13462646 CTCTATCTGATGAGAGTTTCAGG - Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
951444170 3:22757723-22757745 CTCTTTCTGATCAGATTCTCGGG - Intergenic
954920659 3:54187988-54188010 CTCTCTTTGATAAGAGTGCCTGG - Intronic
955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG + Intronic
960672691 3:120167925-120167947 CTCTTTCTGGTAGGAGACTCTGG + Exonic
962070598 3:132029610-132029632 CTCTTTCTTATCCAAGTGTAGGG - Intronic
962514285 3:136135513-136135535 CCCTTTCTGATACCTGAGTCTGG - Intronic
963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG + Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG + Intronic
970398908 4:15699536-15699558 CTCTTTCTGTTCCCAGTTTCAGG - Intronic
972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG + Intergenic
979650795 4:123128406-123128428 CTTTTTCTGATACTTGAGTCAGG + Intronic
982219307 4:153111231-153111253 CTCTCTCTGATAGGAGTATTTGG - Intergenic
988578256 5:32446472-32446494 CTCTTTCTGAAATGAGTAACAGG - Intergenic
989025965 5:37068831-37068853 CTCTTTCTGAAACAAGTCTCAGG + Intergenic
989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG + Intergenic
994138407 5:96315510-96315532 CTCTTTCTGATCTCAGTTTCTGG - Intergenic
995690056 5:114815648-114815670 GTCTTTCTGATACCAAAGTCTGG - Intergenic
995885078 5:116885310-116885332 CTCTTTCTCATACAAGGTTCGGG + Intergenic
1006991051 6:38215108-38215130 CTCTTTCTGATTCTATTGTCAGG + Intronic
1007969237 6:46034070-46034092 TTCTTCCTGTTACCAGTGTCTGG + Intronic
1008894773 6:56540357-56540379 TTCTTGCTGATACGAATTTCAGG + Intronic
1012577209 6:100817860-100817882 CTCTTTTTGTAACGAGTGTGAGG - Intronic
1012826480 6:104152536-104152558 CTCTTTTTGTTACCAGTTTCAGG - Intergenic
1014644975 6:123961701-123961723 CTCTTTTTGATAATAGTGTAGGG + Intronic
1015249131 6:131108241-131108263 CTCTTTCTGTTCCCAGTTTCAGG - Intergenic
1016453370 6:144206841-144206863 ATCTTTCTGATGTGAGTGTTTGG + Intergenic
1017030319 6:150215141-150215163 CTCTTTCTCATACAACTGTGGGG - Intronic
1018301069 6:162403611-162403633 CTATTTCTGACACCTGTGTCAGG - Intronic
1020849538 7:13333733-13333755 CTCTTTCTGATGGGAGGGTAAGG - Intergenic
1021565040 7:22008444-22008466 CTATTCCTGAAACGAGTGTTAGG - Intergenic
1022307904 7:29166388-29166410 TTCTTTCTGATTTAAGTGTCTGG + Intronic
1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG + Intergenic
1034880949 7:154762121-154762143 GTCATTCTGATACTAGAGTCGGG - Intronic
1038477035 8:27875758-27875780 ATCTTTCTAAAACGAGTGCCTGG - Intronic
1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG + Intronic
1051831678 9:21285925-21285947 AACTATCTGATACCAGTGTCAGG - Intergenic
1058615092 9:106817834-106817856 CTCTTTTTGATACCAGGGACCGG + Intergenic
1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG + Intergenic
1186808122 X:13160592-13160614 CTCTTTCTGAGACAGATGTCTGG - Intergenic
1188550033 X:31353396-31353418 CTCTTTCTGATCTCAGTCTCAGG - Intronic
1193266691 X:79480438-79480460 CTCATTTTGATACCAGTCTCTGG - Intergenic
1196086490 X:111688848-111688870 TTCTTTCTGATTAGAGTGTGTGG + Intronic
1200608157 Y:5292207-5292229 CTTTTTTTGATACGTTTGTCTGG + Intronic
1201921429 Y:19237502-19237524 CTCTGTCTTATATGAGTGACTGG + Intergenic