ID: 1183444491

View in Genome Browser
Species Human (GRCh38)
Location 22:37844157-37844179
Sequence GGGCGAGTGCGCGGTGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183444491_1183444494 -8 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444494 22:37844172-37844194 ACTCGCCCTCCGAGCTCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 21
1183444491_1183444498 3 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444498 22:37844183-37844205 GAGCTCGAGTGGCCTGAGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 126
1183444491_1183444500 23 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444500 22:37844203-37844225 CGGCTCGTCGTCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 50
1183444491_1183444501 26 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444501 22:37844206-37844228 CTCGTCGTCCGCGTCCCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 50
1183444491_1183444502 29 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444502 22:37844209-37844231 GTCGTCCGCGTCCCCGGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183444491 Original CRISPR GGGCGAGTGCGCGGTGGCGC CGG (reversed) Exonic