ID: 1183444491

View in Genome Browser
Species Human (GRCh38)
Location 22:37844157-37844179
Sequence GGGCGAGTGCGCGGTGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183444491_1183444500 23 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444500 22:37844203-37844225 CGGCTCGTCGTCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 50
1183444491_1183444494 -8 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444494 22:37844172-37844194 ACTCGCCCTCCGAGCTCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 21
1183444491_1183444502 29 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444502 22:37844209-37844231 GTCGTCCGCGTCCCCGGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 72
1183444491_1183444498 3 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444498 22:37844183-37844205 GAGCTCGAGTGGCCTGAGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 126
1183444491_1183444501 26 Left 1183444491 22:37844157-37844179 CCGGCGCCACCGCGCACTCGCCC 0: 1
1: 0
2: 4
3: 17
4: 270
Right 1183444501 22:37844206-37844228 CTCGTCGTCCGCGTCCCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183444491 Original CRISPR GGGCGAGTGCGCGGTGGCGC CGG (reversed) Exonic
900414669 1:2529496-2529518 GGGCTGGTGCGCGGCGGCGGCGG + Exonic
901109772 1:6785439-6785461 GGGCGGGTGCGCGGCGGCGGCGG + Exonic
901242844 1:7704893-7704915 GGGTAGGTGCGCGGCGGCGCGGG + Intronic
902476739 1:16692469-16692491 GGGCGGGCGGGCGGTGGCGGCGG + Intergenic
903520964 1:23949450-23949472 CGGTGAGTGAGAGGTGGCGCTGG + Intergenic
903597019 1:24502809-24502831 GGGCGCGCGCACGGCGGCGCAGG - Intronic
903674472 1:25055446-25055468 GGGCGGGTGGGCGCTGGGGCAGG - Intergenic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
904753408 1:32754896-32754918 GGGAGAAGTCGCGGTGGCGCGGG - Intronic
905279871 1:36842194-36842216 GAGCTAGTGAGCGGTGGAGCAGG + Intronic
906087453 1:43148111-43148133 GGGCGAGAGCGGGAGGGCGCCGG + Intronic
906144208 1:43550360-43550382 GGGCGAGTGCGCCTGGGGGCGGG - Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
912685005 1:111755576-111755598 CGGCGAGAGGGCGGTGGCGCCGG + Exonic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
920496208 1:206456727-206456749 GGGTGGGTGAGCGGTGGCCCCGG + Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
921934877 1:220787028-220787050 GGGCCTGACCGCGGTGGCGCTGG + Exonic
923400760 1:233614037-233614059 GGGCGGGCGCGCGGGGGAGCGGG + Exonic
923650249 1:235866911-235866933 TGGGGAGTGCGCGGCGGCGGCGG - Exonic
924409314 1:243786687-243786709 GGGGGGGTGCGCGGTGGAGATGG + Intronic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1065551679 10:26873826-26873848 GGGGCAGAGCGCGGTGGCTCAGG - Intergenic
1067809732 10:49417698-49417720 GGGCGAGTGCTAGGGGCCGCGGG - Intergenic
1070198030 10:74176834-74176856 GGACGCGGGCGCCGTGGCGCTGG + Intronic
1071529312 10:86377044-86377066 GGGCAATTGCGCGGTGGCTCAGG - Intergenic
1073301478 10:102473631-102473653 GGGCGTCTACGCGGTGGTGCGGG + Exonic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1074884475 10:117683773-117683795 GGGCGAGAGCCCAGTGGCGGTGG - Intergenic
1076749974 10:132537703-132537725 GGGCCTGTGCGGGGTGGAGCCGG - Intergenic
1076948519 10:133666815-133666837 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076949506 10:133670125-133670147 GGGGGAGGGCGTGGTGGCGGTGG - Intronic
1076950490 10:133673424-133673446 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076951477 10:133676723-133676745 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076952467 10:133680033-133680055 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076953453 10:133683343-133683365 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076955423 10:133742994-133743016 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076956413 10:133746304-133746326 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076957401 10:133749613-133749635 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076958388 10:133752923-133752945 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076959374 10:133756222-133756244 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076960361 10:133759532-133759554 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1077037585 11:502825-502847 GGGCTAGTGTGCCGTGGGGCAGG - Exonic
1077250054 11:1556992-1557014 GGGGGAGCGCGCGGGGGAGCCGG + Exonic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077410879 11:2403383-2403405 GGGCGAGGGCCCTGTGGAGCTGG + Exonic
1079035200 11:17014433-17014455 GGGGGAGGGGGCGGGGGCGCGGG + Intronic
1080012284 11:27471840-27471862 GGGGGTGTGCGCGGTGGGGTGGG + Intronic
1081567884 11:44270873-44270895 GGGCCAGGGCGGGGTGGCCCAGG + Intronic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1083171987 11:60928637-60928659 GGGCGCCTGCGTGGTGGAGCTGG + Exonic
1083253672 11:61483599-61483621 GGTGGAGTGCGGGGTGGGGCGGG + Intronic
1083680499 11:64349506-64349528 GGGCGAGGGTGGGGTGGGGCTGG + Intronic
1083995225 11:66268452-66268474 GGGAGTGGGCGCGGAGGCGCGGG + Intergenic
1084087571 11:66861619-66861641 GGAGGAGTGGGCGGGGGCGCGGG + Intronic
1084264017 11:67995857-67995879 TGGCGTGTGCTCGGTGGGGCTGG - Exonic
1084517014 11:69642760-69642782 GGCGGCGTGCGCGGCGGCGCGGG - Intronic
1084539075 11:69775375-69775397 GGGCGAGTAGGAGGGGGCGCCGG - Exonic
1084809402 11:71603266-71603288 TGGCGTGTGCTCGGTGGGGCTGG + Intronic
1085322469 11:75583448-75583470 GTGCGAGTGCGCGGGGACGGGGG + Intergenic
1085574403 11:77589679-77589701 GGGTGAGTGCGCGGTGGGCTCGG + Exonic
1085641617 11:78196530-78196552 AGGCGAGCGCGCGGGGGCCCGGG - Exonic
1089603135 11:119627138-119627160 GTGAGAGTGCGTGGTGGGGCGGG + Intronic
1090876280 11:130791577-130791599 GGGCATGTGTGCGGTGGTGCTGG + Intergenic
1091221790 11:133934141-133934163 GGGGGAGTGGGTGGTGACGCTGG + Intronic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1094466057 12:30754836-30754858 ACGCGAGTGCGGGGTGGCGCCGG - Intronic
1094682626 12:32679541-32679563 GCGGGAGTGGGCGCTGGCGCGGG - Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096722266 12:53532210-53532232 GGGCGAGTGGGCAGGGGAGCTGG - Intronic
1096741253 12:53695655-53695677 AGGCGAGGGCGCGCTGGGGCGGG + Intergenic
1098425846 12:70365766-70365788 GGGCTGGCGCGCGGTGGTGCCGG - Intergenic
1100468985 12:94873619-94873641 GGGTGAGTGCGCCGTCGCCCCGG - Intergenic
1100594526 12:96060560-96060582 GGGCGAGTGCTTTGGGGCGCTGG + Intergenic
1102278392 12:111599519-111599541 GGGCGGGCGCGCCGAGGCGCCGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1104940332 12:132392095-132392117 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940359 12:132392152-132392174 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940385 12:132392209-132392231 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940412 12:132392266-132392288 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940466 12:132392380-132392402 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1105388875 13:19958193-19958215 GGGCGAGGCCGGGGAGGCGCTGG - Intergenic
1107605151 13:42049012-42049034 TGGAGAGGGCGCGGGGGCGCTGG + Intronic
1108408305 13:50125434-50125456 GGGGGCGGGCGCGGCGGCGCGGG - Intronic
1111993287 13:95137977-95137999 GGGAAAGTGGGCGGTGGGGCGGG + Intronic
1112290903 13:98143394-98143416 GGCCGAGGGCGCGGCGGCGCCGG - Intronic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113473216 13:110561536-110561558 GGGAGAGGGCGCGGGGGCGCTGG - Exonic
1113878265 13:113608046-113608068 GGCTGAGTGCACGGTGGCCCTGG + Intronic
1113917778 13:113884428-113884450 GGGCCAGCGCGCGGGGGCGCCGG + Intergenic
1114485240 14:23057888-23057910 GGGCGAGCGCGCGGTGAGGTGGG + Intergenic
1117119708 14:52553622-52553644 GGGCGGGTGCGCGGGGCCGCCGG + Intronic
1118796961 14:69152720-69152742 GGGAGGGTGCGGGGAGGCGCGGG + Intronic
1122117765 14:99536222-99536244 GGGCGAGGGCTCGGAGGGGCTGG - Intronic
1122710637 14:103654943-103654965 GGCCGAGTGCGGTGTGGCTCAGG + Intronic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124497104 15:30193283-30193305 GGGCGAGGGTGAGGTGGAGCTGG - Intergenic
1124746472 15:32345364-32345386 GGGCGAGGGTGAGGTGGAGCTGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128067849 15:64775580-64775602 CGGCGAGTGCGCCGCGGCGGCGG + Exonic
1128833015 15:70786647-70786669 GGGGGATTGTGCGGTGGCTCAGG - Intergenic
1129322075 15:74781012-74781034 GGGAGAGTGCAGGGTGGCGGGGG - Intergenic
1130335342 15:82952872-82952894 CGGCGACTGCGCGGCTGCGCGGG - Intronic
1131393572 15:92069102-92069124 GGGGGAGTGGGGGGTGGCGGGGG - Intronic
1132697969 16:1210335-1210357 GGGCGGGTGAGAGGTGGGGCGGG - Intronic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134509327 16:14833860-14833882 GGGCCAGGGCGCGGGGCCGCTGG + Exonic
1134697032 16:16232675-16232697 GGGCCAGGGCGCGGGGCCGCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1137988616 16:53130960-53130982 AGGCGGGTGCGTGGCGGCGCGGG + Intronic
1138428361 16:56951418-56951440 GGGAGGGTGAGCGGTGGCCCTGG + Intergenic
1138552657 16:57755933-57755955 GGGGGAGTGGGCGGAGGGGCAGG + Intronic
1139393555 16:66621881-66621903 GGGCGGGTCCGCGGTGGAGTTGG - Intronic
1139467750 16:67163265-67163287 GGCCGAGAGCGCGCAGGCGCGGG - Exonic
1139754592 16:69132401-69132423 GGGCGAGGGCGCGAGGGAGCGGG - Intronic
1140404010 16:74695646-74695668 GGCCGAGGACGCGGTGGCCCAGG + Exonic
1140442635 16:74999293-74999315 GGGCGGGCGCGGGGAGGCGCCGG - Exonic
1140480170 16:75258103-75258125 GGGCCAGTGTGTGATGGCGCAGG - Intronic
1142136287 16:88453372-88453394 CGGCGAGTGCGCGGGAGCGGAGG + Exonic
1142285875 16:89171369-89171391 GTGAGAGTGCGGGGTGGGGCCGG - Intergenic
1142549928 17:732391-732413 GGGCGGGTGGGCGGGGGCGGAGG - Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1145370504 17:22303030-22303052 TGGCGACTGCGCGGTGGCAGGGG - Intergenic
1145885747 17:28381401-28381423 GCGCCACTGCGCGCTGGCGCTGG + Exonic
1147743154 17:42680008-42680030 GGGGGCGAGCGCCGTGGCGCAGG - Exonic
1148323568 17:46771312-46771334 GGGCGAGTGAGCGGCGCGGCTGG - Intronic
1148691342 17:49528614-49528636 GGGCGGGTGGGCTGTGGGGCTGG - Intergenic
1151757904 17:76085255-76085277 GGAAGAGTGCGTGGTGGCACAGG + Intronic
1152103565 17:78316341-78316363 GGGCGAGTGCGTGGTGGAGCAGG + Intergenic
1152313137 17:79563003-79563025 GGGCGAGTGCTGGCTGGCACAGG - Intergenic
1152349726 17:79778007-79778029 GGGCGGGTGCGGGGCGGGGCGGG - Intergenic
1152538407 17:80963222-80963244 GGGCGAGTGCAGGGTGGGGCAGG - Intronic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152711379 17:81871817-81871839 GGGCGAGAGCGCTGGCGCGCGGG + Intergenic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1160164299 18:76496152-76496174 GGGCGGGCGCGCGGGGGCGGGGG + Intronic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160726796 19:620982-621004 GGGGGAGGGCGCGGGGGCGCCGG + Intronic
1160726807 19:621003-621025 GGGGGAGGGCGCGGGGGTGCCGG + Intronic
1160831932 19:1108300-1108322 GGGGGAGGGCGCGGGGGCGGGGG - Exonic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG + Intergenic
1161063221 19:2225679-2225701 TGGCGTGTGCGCGGAGGCCCTGG - Intronic
1161207206 19:3047301-3047323 GGGCGGGCGGGCGGAGGCGCGGG - Intronic
1161290584 19:3491662-3491684 GCACGAGTGCGCGGAGGCCCTGG - Exonic
1161508508 19:4657449-4657471 GGGCGGGTGGGCGGTGTCTCTGG - Intronic
1162421041 19:10566187-10566209 GGGCGGGTGGGCGGTGGCCGCGG - Intergenic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163559111 19:18008668-18008690 AGGCGACTGAGCGGTTGCGCTGG - Intronic
1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1165938238 19:39402698-39402720 GGCCGAGTGCGCGGGCGAGCTGG - Intergenic
1166100862 19:40570640-40570662 GTGTGAGTGGGCGGTGGCGGAGG - Exonic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167369495 19:49072207-49072229 GGGCGAAGGCGCGGCGGGGCAGG + Exonic
1168645872 19:58059186-58059208 GGGCGAGAGCGAGGTGGGGGAGG + Intergenic
1202707291 1_KI270713v1_random:32947-32969 GGGCAGGTGCGCGGTGCCCCTGG + Intergenic
925005723 2:441666-441688 GGGCAAGCGCGTGGTGGAGCAGG + Intergenic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927713753 2:25340753-25340775 GGGAGTGTGCGCGGGGGTGCTGG + Intronic
928518359 2:32064261-32064283 GGGGGAGGGGGCGGCGGCGCCGG + Intronic
931348970 2:61471282-61471304 GGGCGAGCGCGCGGAGGGGGTGG - Intergenic
932599174 2:73112384-73112406 GGGCCAGGCCACGGTGGCGCTGG - Exonic
932772712 2:74509984-74510006 AGGAGAGTGAGCGGTGGGGCTGG + Intergenic
936104851 2:109614905-109614927 CGGCCAGTGCGCGGGGGCGGGGG - Exonic
936452841 2:112646178-112646200 GGGCGCGGACGCCGTGGCGCTGG + Intronic
937439826 2:121906302-121906324 GGGGGTGGGGGCGGTGGCGCGGG - Intergenic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942928119 2:181457442-181457464 GGGCGAGTGCGCGGCATCCCAGG + Exonic
945101313 2:206264446-206264468 GGGCAAGTGCGCGGTGGGAGCGG - Intergenic
946412533 2:219522435-219522457 GGGCGACTGCCCGGTGGGGTCGG + Intronic
947353633 2:229271305-229271327 CGGCGAGCGCGCGGCGGCGGCGG + Intergenic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040183 2:241844332-241844354 AAGTGAGTGCGCGGCGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168790300 20:571878-571900 GGGCGAGGGCGGGGCGGGGCTGG - Intergenic
1170809116 20:19659806-19659828 GGGGGAGTGGGCGGTGGGGTAGG - Intronic
1173165957 20:40687698-40687720 GGGCGGGTGCGCGGGCGGGCAGG - Exonic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1178487341 21:33027458-33027480 TGCCGGGTGCGCGGTGGCGGCGG - Exonic
1180259775 21:46661448-46661470 TGGGGCGGGCGCGGTGGCGCCGG + Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183504673 22:38202448-38202470 GGGCGGGTAGGCGGCGGCGCCGG + Intronic
1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG + Exonic
1183856148 22:40636429-40636451 GGGCGAGGCCGCGGTGGGGGAGG + Intronic
1184046759 22:41976873-41976895 CGGGGAGGGCGCGGCGGCGCGGG + Exonic
1184207561 22:43014828-43014850 GGGCGAGTGCTCGGGGCCCCGGG - Intronic
1185259634 22:49854150-49854172 GGGCGGGTCCGGGGCGGCGCCGG - Intronic
1185269882 22:49924580-49924602 GGGCGAGTGCACAGTGACCCTGG - Intronic
1185320196 22:50197186-50197208 GGGCGGGTGCGGGGGTGCGCTGG - Intronic
949292823 3:2485289-2485311 GGGCGGGCACGCGGTGGCACGGG + Intronic
949616535 3:5759963-5759985 GGGAGAGTGGGCGGGGGCGGGGG - Intergenic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950710559 3:14810597-14810619 GGGCGCGAGCGCGGGGGCGGCGG - Intergenic
953724765 3:45388446-45388468 GGGCGTCTGCGCGGCGGCCCGGG - Intergenic
955916506 3:63912755-63912777 GGCCGTGTGCGCCGTGGCGGCGG - Exonic
961545461 3:127629751-127629773 GGGCGGGTACGCTGAGGCGCGGG + Intronic
967904010 3:194486529-194486551 GGGCGGGTGGGCAGCGGCGCCGG - Intronic
968066570 3:195762491-195762513 GGCCGAGTGCGTTGTGGTGCCGG - Intronic
968514847 4:1011713-1011735 GGGCGAGTCCGCGGGGCCGGGGG - Intronic
968556534 4:1248776-1248798 GTGCGAGTGCGCGTGCGCGCCGG - Intronic
968659507 4:1793288-1793310 GGCTCAGTGCGCGGTGGCGGCGG + Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
969022529 4:4147767-4147789 TGGCGTGTGCTCGGTGGGGCTGG - Intergenic
969790959 4:9493741-9493763 TGGCGTGTGCTCGGTGGGGCTGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG + Exonic
972686854 4:41360597-41360619 GGGAGCGAGCGCGGAGGCGCCGG - Intronic
974354848 4:60798136-60798158 GGGAGGGTGCGGGGTGGGGCGGG + Intergenic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975666792 4:76741097-76741119 GGGCGTGTGCGGGGAGGCGGAGG - Exonic
981475176 4:145180403-145180425 TGGGGAGTGCGCGGGGGCGCAGG - Intergenic
985451973 4:190067620-190067642 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985452960 4:190070911-190070933 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985453949 4:190074204-190074226 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985454937 4:190077497-190077519 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985455923 4:190080794-190080816 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985456908 4:190084088-190084110 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985457896 4:190087384-190087406 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985458884 4:190090681-190090703 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985463136 4:190173444-190173466 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985577115 5:678626-678648 GGGAGGGTGCGTGGTGGCCCTGG + Intronic
986297071 5:6448683-6448705 GGGCAAGCGCGCGGCGGAGCTGG + Exonic
988609515 5:32711733-32711755 GGGCGAGTCGGCGGCGGCGAGGG + Exonic
995043018 5:107610338-107610360 GGGCGGGTGCGCCGTGAGGCTGG - Intronic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
998130288 5:139648334-139648356 GGGCGGGCGCGCGGCGGCGGCGG + Exonic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
999268822 5:150284553-150284575 GGGCGGCTGCGCGGGGGCGGAGG + Intronic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001653230 5:173329695-173329717 GGGCGAGTGCGCGCCAACGCCGG - Intergenic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1004143489 6:13043436-13043458 AGGCGGGTGGGGGGTGGCGCTGG + Intronic
1004272826 6:14210885-14210907 GGGGCAGTGGGCGGCGGCGCGGG - Intergenic
1006085641 6:31593041-31593063 GGGTGAGTGGGCGGTTGGGCGGG + Intergenic
1007316714 6:40995003-40995025 AGGCCAGGGCGCGGTGGCTCAGG - Intergenic
1011042517 6:83046674-83046696 GGGGGGGTGGGCGGTGGCACCGG + Intronic
1013619286 6:111872883-111872905 GGCGGCGTGCGCGGGGGCGCCGG + Intronic
1017971492 6:159315806-159315828 GGGCGAGTGCGAGGAGGAGAAGG - Intergenic
1018909399 6:168093371-168093393 GGCCGAGTGTGAGGTGGGGCCGG - Intergenic
1019114905 6:169751945-169751967 AGGGCTGTGCGCGGTGGCGCGGG + Intronic
1019562567 7:1665878-1665900 GGGCGAGCGCGGGGCGGCGGCGG - Intergenic
1019676288 7:2314473-2314495 GGGCGAGGGCGCGGCGCGGCAGG - Intronic
1020278289 7:6637464-6637486 GGGCCGGTGGGCGGCGGCGCGGG + Intronic
1021668688 7:23013735-23013757 GGGTGGGTGCGAGGCGGCGCGGG - Intronic
1021958908 7:25852957-25852979 GGACGACTGCGCTGGGGCGCGGG - Intergenic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1032019066 7:128396561-128396583 GAGCGAGTGCCCGCTGGCCCCGG - Intronic
1032344323 7:131105829-131105851 AGGCGAGGGCGCGGTGACACGGG - Intergenic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035265157 7:157686004-157686026 GGGCGACCGCGCGGGGCCGCGGG + Intronic
1035385489 7:158469594-158469616 GAGCGAGTGCTCGGTGGAGCTGG - Intronic
1037305248 8:17497319-17497341 GGGCGAGGGCGCCCTGGGGCCGG + Intronic
1037825302 8:22156823-22156845 GGGCGCGCGCGGGGCGGCGCGGG + Exonic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1039903261 8:41767655-41767677 GGGGGTGCGCGCGGGGGCGCGGG + Intronic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1049548537 8:143246097-143246119 GGGCGCGCACGCGGTGGCGGCGG + Intergenic
1049742796 8:144249071-144249093 GGGAGAGGGCGCGGTGGGACGGG + Intronic
1055245068 9:74229964-74229986 GGGGGAGTGCGAGGTGGCAAGGG + Intergenic
1056413493 9:86354619-86354641 GAGCGAGTGCGCTGGGGCGCCGG - Intergenic
1057422890 9:94926626-94926648 GGGGGAGTGCCCTGTGGGGCAGG + Intronic
1057483495 9:95463667-95463689 TGGTGAGTGTGGGGTGGCGCTGG + Intronic
1057546223 9:96021773-96021795 GGGCGGGAGGGCGGAGGCGCCGG + Intergenic
1057758365 9:97854102-97854124 GGGCGCGTGCGCGATGGCCATGG - Exonic
1058508891 9:105694771-105694793 GGGTGAGTGCGGGGCGCCGCGGG + Exonic
1058885840 9:109320705-109320727 GGGAGAGCGCGCGGCGGCGGCGG - Exonic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1061975661 9:134067174-134067196 GGGCGAGGGCGAGTTGGAGCGGG - Intronic
1062653590 9:137590627-137590649 GGGCGAGTGCGCCGGCGCTCTGG + Intergenic
1062659180 9:137619292-137619314 GGGGGAGCGGGCGGGGGCGCAGG + Intronic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1189005022 X:36986012-36986034 GGGCCAGTGCGAGGAGGCGGTGG - Intergenic
1192079440 X:68032949-68032971 GGGAGAGTGCCAGGTGGGGCAGG - Intergenic
1199974285 X:152883711-152883733 GGGCTAGTGAGTGGTGGAGCTGG - Intergenic
1201178209 Y:11322471-11322493 AGGGGAGTCCGCGGTGGGGCTGG + Intergenic