ID: 1183445252

View in Genome Browser
Species Human (GRCh38)
Location 22:37849346-37849368
Sequence ACTCGGGCCTGCCGGGAAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183445252_1183445261 0 Left 1183445252 22:37849346-37849368 CCGGTTTCCCGGCAGGCCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1183445261 22:37849369-37849391 GGGGCTGAACTTCCGGCCTCAGG 0: 1
1: 0
2: 0
3: 24
4: 552
1183445252_1183445259 -7 Left 1183445252 22:37849346-37849368 CCGGTTTCCCGGCAGGCCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1183445259 22:37849362-37849384 CCCGAGTGGGGCTGAACTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 76
1183445252_1183445264 12 Left 1183445252 22:37849346-37849368 CCGGTTTCCCGGCAGGCCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1183445264 22:37849381-37849403 CCGGCCTCAGGACGCAGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 139
1183445252_1183445265 13 Left 1183445252 22:37849346-37849368 CCGGTTTCCCGGCAGGCCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1183445265 22:37849382-37849404 CGGCCTCAGGACGCAGGCGCGGG 0: 1
1: 0
2: 3
3: 18
4: 166
1183445252_1183445262 7 Left 1183445252 22:37849346-37849368 CCGGTTTCCCGGCAGGCCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1183445262 22:37849376-37849398 AACTTCCGGCCTCAGGACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183445252 Original CRISPR ACTCGGGCCTGCCGGGAAAC CGG (reversed) Exonic
903647251 1:24902841-24902863 ACACAGACCTGCCGGGAAGCTGG + Intronic
908351095 1:63286732-63286754 ACTGGGGCCAGCCTGGAAACTGG - Intergenic
911187274 1:94916371-94916393 ACTCCAGCCTGGGGGGAAACAGG + Intronic
911535826 1:99099003-99099025 ACTGGGGCCTGTTGGGGAACAGG - Intergenic
913399179 1:118409134-118409156 ACTGGGGCCTGTCGGGGAATGGG + Intergenic
917194370 1:172450154-172450176 TCACGGGTCAGCCGGGAAACTGG - Intronic
923692824 1:236212449-236212471 ACTTGGGCCTGCCAAGAGACTGG - Intronic
923985176 1:239373788-239373810 ACTAGGGCCTGCCGGGAGGTGGG + Intergenic
1065493463 10:26305873-26305895 ACTCAAGCCTGTCGGGCAACCGG - Intergenic
1065872623 10:29968614-29968636 CCTGGGGCCTGACGGGAAAAGGG - Intergenic
1073520393 10:104122510-104122532 CCTCGGGCCGGCAGGGTAACGGG + Intronic
1075224731 10:120618048-120618070 ACTAGGGCCTGCAGGGAGAGAGG + Intergenic
1077332390 11:1989317-1989339 ACACCGGCCTGCTGGGAAGCTGG + Intergenic
1077442408 11:2574858-2574880 ACTGGGGCCTTCGGGGACACAGG - Intronic
1079489509 11:20972011-20972033 ACTGGGGCCTGCTGGGGAGCGGG + Intronic
1202815371 11_KI270721v1_random:44493-44515 ACACCGGCCTGCTGGGAAGCTGG + Intergenic
1091893173 12:4078657-4078679 ACTGGGGCCTGTCGGGGAAGAGG + Intergenic
1096567199 12:52491798-52491820 TCCCGGACCTGCCAGGAAACCGG - Intronic
1097787741 12:63779850-63779872 GCTGGGGACTGCCTGGAAACGGG + Exonic
1099022464 12:77423623-77423645 ACTGGGGCCTGTCGGGAGATCGG - Intergenic
1103890996 12:124239054-124239076 ACTCTGCCCTCCAGGGAAACAGG - Intronic
1106303881 13:28494211-28494233 ACTCGTGCCTGCGGGGGAGCAGG - Intronic
1129658715 15:77541469-77541491 ACCCGGGCCTGCTGGGGCACTGG - Intergenic
1139632915 16:68241327-68241349 TCTCGGGGCTGCAGGGAGACTGG + Intergenic
1141225194 16:82108355-82108377 ACTGGGGCCTGCTGGGAGGCAGG + Intergenic
1142708415 17:1710318-1710340 CCCCAGCCCTGCCGGGAAACGGG - Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1151649816 17:75459879-75459901 ACCCAGGCCTGCTTGGAAACGGG - Intronic
1152473189 17:80501571-80501593 CGTGGGGCCTGCCGGGAAGCAGG + Intergenic
1155833594 18:30549156-30549178 ACTGGGGCCTGCCAGGAAGTTGG - Intergenic
1160796003 19:945710-945732 ACACGGGCCTGCCTGGAGTCCGG - Intronic
1163635815 19:18436894-18436916 ACTCGGCCCTGCCCGGATCCTGG + Intronic
1166995697 19:46718743-46718765 ACTGGGGCCTGCTGGGGGACTGG + Intergenic
1168296117 19:55378007-55378029 ACACGGACCCGCCAGGAAACCGG - Exonic
925183133 2:1829853-1829875 CCTAGGGCCTGCCAGGAGACAGG - Intronic
926318406 2:11729134-11729156 ACCAGGGCCTGTCGGGGAACGGG + Intronic
931489583 2:62729830-62729852 ACTCGAGGCTGTGGGGAAACAGG - Intronic
948206399 2:236164706-236164728 ACTGAGGGCTGCCGGGAAGCCGG + Intergenic
1171459439 20:25290653-25290675 ACTCACTCCTGCCGGGGAACGGG + Intronic
1175374731 20:58516185-58516207 ACTCGTGAGTCCCGGGAAACAGG - Intergenic
1178376141 21:32068929-32068951 GCTCGGGGCTGCCAGGAGACTGG + Intergenic
1180054294 21:45349196-45349218 ACTCTGGCCTGCTGGGGACCCGG - Intergenic
1181745695 22:24953553-24953575 ACGCGGGCCTGCCTGGTAACAGG - Intronic
1181798868 22:25331007-25331029 ACTCGGGCCTGTCGGGGCAGGGG - Intergenic
1183445252 22:37849346-37849368 ACTCGGGCCTGCCGGGAAACCGG - Exonic
1184481732 22:44752348-44752370 ACGCGGCCCAGCCGGGAATCGGG + Intronic
1184582960 22:45429566-45429588 CCTCTGGCCTGCAGGGAAGCAGG - Intronic
950050713 3:9986895-9986917 CGTCGGGCCTGGCGGGAAAGTGG + Exonic
964194741 3:154049538-154049560 ACTGGGGCCTGTCGGGAGATGGG - Intergenic
966224501 3:177583473-177583495 ACTGGGGCCTGTCGGGGTACTGG + Intergenic
967572515 3:191046834-191046856 ACTGGGGCCTGTCGGGAGGCAGG + Intergenic
969900026 4:10340542-10340564 ACTGGGGCCTGTCGGGAAGTGGG + Intergenic
982323139 4:154101204-154101226 CCTCGTGCCTGCAGGGATACAGG - Intergenic
985957637 5:3276783-3276805 ACGCGGCCCTGCAGGGCAACAGG + Intergenic
987223222 5:15812324-15812346 ACTGGGGCCTGTGGGGAAATGGG + Intronic
992601966 5:78410303-78410325 ACTGGGGCCTGTCGGGAGATGGG - Intronic
1001526984 5:172436204-172436226 ACTCAGGCCAGCAGTGAAACTGG + Intronic
1003032358 6:2612975-2612997 ACTGGGGCCTGTCGGGAGATGGG + Intergenic
1005968341 6:30742756-30742778 AGCGGGGCCTGCCGGGAAAGGGG - Intergenic
1011743813 6:90389397-90389419 GCTGGGGCCTTCAGGGAAACTGG + Intergenic
1013023998 6:106251260-106251282 ACTCTGGCCTGGCGGGAAGAGGG + Intronic
1026539480 7:71267865-71267887 ACTGGGGCCTGCTGGGAAGTGGG - Intronic
1030778537 7:113567581-113567603 ACTGGGGCCTGCCAGGAGATAGG + Intergenic
1032490081 7:132318014-132318036 ACTCGGGTCTTCAGGGAAAATGG - Intronic
1034431219 7:151042115-151042137 GCTCGGGTCTGCCGGGAACCAGG + Intronic
1036283138 8:7418125-7418147 CCTCTGGCCTGCCAGGAATCAGG - Intergenic
1036338333 8:7893394-7893416 CCTCTGGCCTGCCAGGAATCAGG + Intergenic
1038544139 8:28412395-28412417 GCTCAGGCCTGCCGGGGATCGGG - Intronic
1047076175 8:121406492-121406514 ACTTGGTACAGCCGGGAAACAGG + Intergenic
1049353308 8:142175653-142175675 ACAAGTGCCTGCCGGGAATCGGG - Intergenic
1049747403 8:144268853-144268875 ACTCGGGCCTGTCGGGCACCCGG + Intronic
1053176324 9:35927388-35927410 AGTCTGGCCTGCAGGGAAGCAGG + Intergenic
1061393954 9:130333163-130333185 ACTGGGGCATGCCGGGGACCTGG + Intronic
1062316469 9:135969679-135969701 ACTCTGGCCAGCCGGGACCCAGG + Intergenic
1062546952 9:137068140-137068162 ATTCGGGCCTGCCTGGAGCCAGG - Intronic
1185693731 X:2178312-2178334 ACTAGGGCCTGCCGGGGAGGTGG + Intergenic
1189244040 X:39549555-39549577 ACTGGGGCCTGTCGGGAAGTGGG + Intergenic
1191802453 X:65096202-65096224 ACTGGGGCCTGTCGGGAGATGGG + Intergenic