ID: 1183446206

View in Genome Browser
Species Human (GRCh38)
Location 22:37857116-37857138
Sequence CTTTGGGAGGTGAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151634
Summary {0: 1, 1: 133, 2: 2779, 3: 33601, 4: 115120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183446200_1183446206 -8 Left 1183446200 22:37857101-37857123 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG 0: 1
1: 133
2: 2779
3: 33601
4: 115120
1183446197_1183446206 11 Left 1183446197 22:37857082-37857104 CCAGGCGCGGTGGCTCATGCCTG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
Right 1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG 0: 1
1: 133
2: 2779
3: 33601
4: 115120
1183446195_1183446206 19 Left 1183446195 22:37857074-37857096 CCTCCAGGCCAGGCGCGGTGGCT 0: 12
1: 119
2: 509
3: 1761
4: 3701
Right 1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG 0: 1
1: 133
2: 2779
3: 33601
4: 115120
1183446196_1183446206 16 Left 1183446196 22:37857077-37857099 CCAGGCCAGGCGCGGTGGCTCAT 0: 146
1: 1615
2: 5979
3: 9827
4: 11097
Right 1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG 0: 1
1: 133
2: 2779
3: 33601
4: 115120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183446206 Original CRISPR CTTTGGGAGGTGAAGGTGGA CGG Intronic
Too many off-targets to display for this crispr