ID: 1183453893

View in Genome Browser
Species Human (GRCh38)
Location 22:37911116-37911138
Sequence CAGCCAGCTGTCCCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183453884_1183453893 21 Left 1183453884 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG 0: 1
1: 3
2: 30
3: 362
4: 3908
Right 1183453893 22:37911116-37911138 CAGCCAGCTGTCCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183453893 Original CRISPR CAGCCAGCTGTCCCGTGCTG GGG Intronic
900342819 1:2196891-2196913 CAGCTCTCTGTGCCGTGCTGGGG + Intronic
903121441 1:21219156-21219178 TAGCCATCAGTCCCCTGCTGTGG + Intronic
903157830 1:21460179-21460201 CAGCCAGCAGAGCCGTGGTGAGG - Intronic
903500983 1:23800156-23800178 CAGCCCGCTGTCGCCAGCTGTGG - Intronic
903737737 1:25541056-25541078 CAGCCATGTGTCCCCTGCAGAGG - Intergenic
907140648 1:52182067-52182089 CGGCCAGCTGCCCCGTCCGGAGG + Intronic
910065271 1:83143884-83143906 AAGGCAGCTGTGCTGTGCTGGGG + Intergenic
912499878 1:110114700-110114722 CAGCCAGCACTCCCAGGCTGGGG + Intergenic
914750449 1:150531505-150531527 CAGCCTGCGGTCACTTGCTGGGG + Intergenic
916720630 1:167482600-167482622 CAGCTAGGTCTCCCCTGCTGTGG - Intronic
922795355 1:228337032-228337054 CGGCCACCTGTCCCTCGCTGAGG + Exonic
922979628 1:229814595-229814617 GCGCCAGCTGTCCCCAGCTGAGG + Intergenic
923030795 1:230247691-230247713 CAGCCAGGTGTTCCGTGTGGGGG + Intronic
924615880 1:245611701-245611723 CAGCCAGCTGAATGGTGCTGGGG + Intronic
1063649501 10:7918925-7918947 CAGCAAGCTGTCCGGAGGTGAGG - Intronic
1064144356 10:12815709-12815731 CAGTGAGCTGTGCCCTGCTGGGG - Intronic
1065103417 10:22354711-22354733 TAGCCAGCTGTCCCTTGATTAGG - Intronic
1067273535 10:44813866-44813888 CAGCCAGCTCTCCTGAGCTTTGG + Intergenic
1068438178 10:57017689-57017711 CAACCAGCTGTCCCTTACAGGGG - Intergenic
1068798655 10:61114214-61114236 TATCCAGCTGTCCCATGCTGTGG + Intergenic
1069514675 10:69068246-69068268 CTGCCAGCTCTCCCTTCCTGGGG + Intergenic
1069989167 10:72303932-72303954 CACTCAGCTCTCCCATGCTGGGG - Intergenic
1070598282 10:77848064-77848086 AGGCCAACTGTCCCGTGCTCAGG - Intronic
1070685262 10:78475862-78475884 CATCCAGCTCTCCCATGATGGGG - Intergenic
1073204135 10:101759772-101759794 CAGCCAGCGGACTGGTGCTGCGG - Intergenic
1073767487 10:106699162-106699184 CAGCCAGCTGGGCACTGCTGTGG + Intronic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1076312415 10:129517829-129517851 CAATCAGCAGTCCCGGGCTGCGG - Intronic
1077135064 11:994374-994396 CACCCCGCTGTCCTGTCCTGGGG + Intronic
1077341997 11:2030373-2030395 CTCCCACCTGTCCAGTGCTGTGG + Intergenic
1077998845 11:7476618-7476640 CAGGCAGCTGTCCCATCCTGGGG + Intergenic
1078241587 11:9535348-9535370 GAGCCAGCTGTGCCTTGATGGGG + Intergenic
1079182925 11:18209400-18209422 CAGTCAGCGGTCCCGAGGTGAGG - Exonic
1088805779 11:113350792-113350814 CAGCCAGCTGGCACGGGCCGGGG + Intronic
1089160797 11:116435508-116435530 CAGCCAGCTGTGGTGTGCTTGGG + Intergenic
1202824983 11_KI270721v1_random:85562-85584 CTCCCACCTGTCCAGTGCTGTGG + Intergenic
1091702417 12:2672880-2672902 CAGCTACCTCTCCCGTGATGGGG + Intronic
1091982493 12:4877641-4877663 CTGCCTGCTGACCAGTGCTGGGG + Intergenic
1092347073 12:7724247-7724269 CATCCAGCAGTCCCTTGTTGGGG - Intergenic
1102010130 12:109613067-109613089 CAGAGAGCTGTCCCTTGCTCAGG + Intergenic
1102255137 12:111410684-111410706 CAGCCAGCTGCCCCGTGGCCTGG + Intronic
1102997315 12:117360673-117360695 CTGCCAGCTGTCCGCGGCTGGGG - Intronic
1104111968 12:125712477-125712499 CAGCAGGCTGTCAAGTGCTGGGG + Intergenic
1104712794 12:130997195-130997217 CGGCCAGCTGCCCCGTCCGGGGG - Intronic
1104773680 12:131380418-131380440 CAGCCAGCTGTCCCTAGCCCTGG + Intergenic
1105006028 12:132721124-132721146 CCCACAGCTGACCCGTGCTGAGG + Exonic
1105335059 13:19459776-19459798 AAGCCAGCTGTGCTGTGTTGTGG + Intronic
1105859864 13:24399612-24399634 AAGCCAGCTGTGCTGTGTTGTGG - Intergenic
1107898497 13:44989323-44989345 CATCCAGCTGTCCCGCGGCGGGG + Exonic
1107958022 13:45535652-45535674 CAGCTGGCTGTGCTGTGCTGTGG + Exonic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1112431398 13:99353870-99353892 GAGCCAGCAGCCCAGTGCTGTGG + Intronic
1112730158 13:102351741-102351763 CAGCCAGCTGTCACATCCTGAGG - Intronic
1113906747 13:113822871-113822893 AAGTCAGCTGTCCTGGGCTGGGG - Intronic
1115770821 14:36662838-36662860 CAGGCAGCTGTCCCAAGCAGCGG + Intronic
1116320356 14:43454475-43454497 AAGGCAGCTGTGCTGTGCTGTGG - Intergenic
1118702541 14:68448083-68448105 CAGCCAGTTGGCCCATACTGAGG + Intronic
1121431255 14:93890037-93890059 CACCCAGCTGTCAGGTGCTGTGG + Intergenic
1121714073 14:96060219-96060241 CAGCCCTGTGTCCTGTGCTGGGG - Intronic
1122649125 14:103216044-103216066 CAGCCTGCTGCCTGGTGCTGAGG + Intergenic
1123206051 14:106714611-106714633 AAGGCAGCTGTGCCGGGCTGAGG - Intergenic
1123211135 14:106762021-106762043 AAGGCAGCTGTGCCGGGCTGAGG - Intergenic
1123998805 15:25737562-25737584 AAGCCAGCCGTCCCGTGCCTGGG - Intronic
1126183578 15:45809659-45809681 GAGCCACCTGTGCCGTGCTTGGG + Intergenic
1128095222 15:64949152-64949174 CAGCTGGCTCTCCAGTGCTGTGG - Intronic
1128313670 15:66646923-66646945 CAGCCAGCTTTCCCTGTCTGGGG - Intronic
1130010810 15:80152403-80152425 CAGCTAGCTGCCCCGAGCGGGGG + Intergenic
1131526974 15:93160220-93160242 CAGCCAGCTGTGGGGAGCTGGGG - Intergenic
1132717563 16:1299517-1299539 CAGCCTGCTGTGCGGAGCTGGGG - Intergenic
1132745479 16:1434528-1434550 CAGCCACCTGTCCAGAGATGCGG + Exonic
1134021797 16:10926156-10926178 CACCCAGCTCTCACTTGCTGGGG - Exonic
1135786171 16:25351193-25351215 CTGCCAGCTGCCAGGTGCTGAGG - Intergenic
1136655821 16:31708614-31708636 CAGCCAGCTGCACTCTGCTGCGG + Intergenic
1137445890 16:48531942-48531964 CGGCCAGCTGGCCTGTGCTCGGG - Intergenic
1139061972 16:63263710-63263732 AAGGCAGCTATCCTGTGCTGTGG + Intergenic
1139355087 16:66362870-66362892 CAGCTGGCTGTGCTGTGCTGAGG - Intergenic
1142146071 16:88493400-88493422 CAGGAAGCTGTCCCGGGGTGCGG + Intronic
1142146084 16:88493440-88493462 CGGAGAGCTGTCCCGGGCTGCGG + Intronic
1142146149 16:88493620-88493642 CAGAGAGCTGTCCCGGGGTGCGG + Intronic
1142993305 17:3746288-3746310 CTTCCAGCTGTGCCGTCCTGGGG - Intronic
1148088713 17:45009852-45009874 CAGACAGCTGTGATGTGCTGTGG + Intergenic
1149364858 17:55933226-55933248 CAGGCACCTGACCCCTGCTGTGG - Intergenic
1149968735 17:61194365-61194387 CAGTCAGCTTTCACTTGCTGGGG - Intronic
1151508732 17:74545550-74545572 CCGCCTGCTGTCCCCTGGTGAGG + Intronic
1151789218 17:76293463-76293485 CACCAAGCTGACCCATGCTGAGG + Exonic
1152239228 17:79152904-79152926 CTGCCAGCACTCCTGTGCTGGGG + Intronic
1152718841 17:81912673-81912695 CAGACAGCTTTCCCGAGCTGGGG - Intronic
1152743886 17:82030532-82030554 TGGCCAGGTCTCCCGTGCTGAGG + Intronic
1152852821 17:82647989-82648011 CAGCCGGCCGTCCCGGGCCGAGG - Intronic
1153012458 18:551478-551500 CAGCCAGGTGTCTTGGGCTGAGG + Intergenic
1153636332 18:7117073-7117095 TAGCCAGCCGTCCCGGGCAGGGG - Intronic
1155768847 18:29672115-29672137 AAGGCAGCTGTTCTGTGCTGGGG - Intergenic
1158847973 18:61464591-61464613 CAGCAAGCTCTACCCTGCTGGGG - Intronic
1160810350 19:1010490-1010512 CAGCCCGCTGGGCCCTGCTGGGG - Exonic
1161046914 19:2139919-2139941 CTGCCAGCTGCACCGGGCTGGGG + Intronic
1161612376 19:5250550-5250572 GAGCCAGCTGGAGCGTGCTGAGG - Intronic
1163822183 19:19502336-19502358 CAGCCAGCTGTCCCGGGGTTCGG + Exonic
1164981663 19:32619139-32619161 CAGCCTGCTTGCCCATGCTGAGG - Intronic
1166869728 19:45864148-45864170 CCCCCAGCTGTCGCGTCCTGGGG + Intronic
1166872633 19:45880097-45880119 CAACCAGGTGACCAGTGCTGGGG - Intergenic
1168164297 19:54536116-54536138 CAGCCAGTTGTTCCCTGCAGTGG + Intronic
1168374208 19:55861818-55861840 CTGCCAGCTGTCCCTTGTGGGGG + Intronic
1168557657 19:57356589-57356611 CAGCCAGATGACTCATGCTGAGG + Exonic
925084751 2:1099347-1099369 CAGCCAGGGGTCCCCTGCAGTGG - Intronic
928178771 2:29053104-29053126 CAGCCTGCAGCCACGTGCTGGGG + Exonic
929794690 2:45049981-45050003 CAGCCTGCTGCCCAGGGCTGTGG + Intergenic
932195992 2:69784467-69784489 CAGAAAGCTGTCTCATGCTGGGG + Intronic
932221899 2:70006175-70006197 TTGCCAGGTGTCCTGTGCTGGGG + Intergenic
935196448 2:100819629-100819651 CACCCTGCTGTCCCGCGCAGGGG - Intergenic
935207546 2:100909574-100909596 CAGCCCACTGTCCAATGCTGAGG - Intronic
935482395 2:103608594-103608616 AAGCCAGCTGTCCTGTCATGAGG + Intergenic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
943351938 2:186806233-186806255 CAGCTAGCTGCACTGTGCTGGGG + Intergenic
943874020 2:193038645-193038667 CAGCCAGCTGTCTTTTCCTGGGG + Intergenic
946026425 2:216674410-216674432 CAGCCAACTGTCCTGTCCAGGGG + Exonic
948527192 2:238578421-238578443 CAGCCAGCAGTCCCAGGATGAGG - Intergenic
948668696 2:239552517-239552539 CAGCCGCCTGTCCTGTGCAGAGG - Intergenic
1169285087 20:4301127-4301149 GAGCCAGCTGTCCTGTTCAGAGG + Intergenic
1169321407 20:4636026-4636048 CAGGCAGCTCTCCTCTGCTGAGG - Intergenic
1172151303 20:32792485-32792507 CAGACAGCTGTCCTGGGCTGTGG - Intronic
1172980995 20:38941583-38941605 CAGCAAGCTGTCTGGTTCTGTGG - Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175384522 20:58585574-58585596 CACTCAGTTGTCCGGTGCTGCGG + Intergenic
1175984394 20:62756700-62756722 AAGCCAGCCGTCCTGAGCTGGGG - Intronic
1182280045 22:29213329-29213351 CAGCCAGCCATCCCATGCAGAGG - Intronic
1182738607 22:32549114-32549136 GATGCAGCTGTCCCCTGCTGAGG - Intronic
1183297964 22:37043284-37043306 CTGCCAGCTGCTCCTTGCTGGGG + Intergenic
1183453893 22:37911116-37911138 CAGCCAGCTGTCCCGTGCTGGGG + Intronic
1184017301 22:41795737-41795759 CAGCCAGGTGTCCCATGCTCTGG - Exonic
1184388735 22:44190920-44190942 CAGCCAGATGCCCTCTGCTGAGG - Intronic
1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG + Intronic
1184962456 22:47941444-47941466 CAGCCAGCTGTCTTGCACTGGGG + Intergenic
950122707 3:10492429-10492451 CACTCAGCTGTCCCGTTCTTTGG - Intronic
953386992 3:42512391-42512413 CAGCCAGCAATCCATTGCTGCGG - Intronic
956468689 3:69542762-69542784 CAGCCCGCAGCCCCGTGCGGCGG - Intergenic
956860078 3:73314325-73314347 CACCCAGCTGTCCCGTGAGGTGG - Intergenic
958111436 3:89151574-89151596 TAGGCAGCTGGCACGTGCTGTGG - Intronic
959173808 3:102878213-102878235 CAGCCAGGTGTCTCATGCCGTGG + Intergenic
960287507 3:115845826-115845848 CTGCCAGCTTCCCCATGCTGGGG - Intronic
960674938 3:120184635-120184657 AAACCAGCTGTCCTGTTCTGAGG + Intronic
961633649 3:128319266-128319288 AAGCCTGCTGTCCCCTGGTGAGG - Intronic
962740050 3:138356911-138356933 CAGGCAGCTGTCCACTGCGGTGG - Intronic
966015349 3:175132451-175132473 CAGCCAGCCGCCCCGTCCGGAGG - Intronic
967913303 3:194559510-194559532 CAGCCTGCTCTCTCTTGCTGTGG - Intergenic
968231100 3:197005055-197005077 CAGCCAGCTCTGCAGTTCTGTGG + Intronic
969703502 4:8780318-8780340 CAGCCAGCTGGGTCCTGCTGCGG + Intergenic
979253450 4:118588685-118588707 CTGCCAGCTGTTCTCTGCTGCGG + Intergenic
981337142 4:143580838-143580860 AAGGCAGCTGTGCTGTGCTGGGG - Intronic
983104716 4:163672363-163672385 CACCAAGCTGTGCCGTGCTGAGG - Intronic
984727232 4:183033342-183033364 CAGCCACATATCCAGTGCTGGGG + Intergenic
985574919 5:669578-669600 CAGCCTGGTGACCAGTGCTGAGG + Intronic
985732631 5:1557782-1557804 AAGCCAGTGGCCCCGTGCTGTGG + Intergenic
985775868 5:1841401-1841423 CACCCAGCTGTGCCGGCCTGGGG + Intergenic
985784377 5:1886394-1886416 CAGCCGGGTGTCCCGAGCGGTGG - Intronic
985789512 5:1917810-1917832 CTGCCAGGTGTTCCGAGCTGTGG + Intergenic
986215060 5:5712530-5712552 CAGCTGACTGTCCTGTGCTGCGG + Intergenic
986477402 5:8149484-8149506 CAGGCAGCAGTCCTGAGCTGAGG + Intergenic
986744016 5:10728718-10728740 CAGCCCCCTGTCCAGTGCTGTGG - Intronic
987456165 5:18149849-18149871 CTGCCAGCATTCCTGTGCTGGGG - Intergenic
991005085 5:61821032-61821054 CAGCCAGCTGTGCTGTTGTGTGG - Intergenic
994873588 5:105384434-105384456 CAGCCTGCTGTCCTGCCCTGTGG - Intergenic
995460353 5:112396680-112396702 AAGCCAGCTGACCTGTGGTGAGG - Intronic
995571594 5:113487846-113487868 CAGATCGCTGCCCCGTGCTGCGG + Intronic
997263105 5:132478684-132478706 CAGCCAGCTATACCCTTCTGAGG + Intergenic
1001299781 5:170525151-170525173 GAGCCAGCTGTCCTGGGCTTTGG + Intronic
1001424798 5:171616121-171616143 CAGCCAGCTGCCCCAGGCAGGGG + Intergenic
1003136539 6:3438921-3438943 CACCCATGTGTCCCGTACTGTGG + Intronic
1006346275 6:33485704-33485726 CAGCCAGCCGCCCCGTCCGGGGG - Intergenic
1006452155 6:34111588-34111610 CAGAAAGCTGTCCCCTGCCGGGG - Intronic
1006987939 6:38189185-38189207 CAGCCTCCTGTCCTATGCTGCGG + Intronic
1007621126 6:43215277-43215299 CAGGCAGATGTCCCTTTCTGTGG + Exonic
1009622439 6:66094796-66094818 CATCCAGCTGTCCCGCGGCGGGG + Intergenic
1018271753 6:162087080-162087102 CCCCCAGCTGTCCAGTGCTCAGG + Intronic
1019267012 7:123387-123409 CAGCCAGCATTCCCCTGCTGGGG + Intergenic
1019515568 7:1438435-1438457 GGGCCAGCTGTGCTGTGCTGAGG - Intronic
1020081997 7:5291248-5291270 CAGGCAGGTGTCCCGTGGCGGGG - Intronic
1021611379 7:22461061-22461083 CAGCTAGCTGTTCCGTATTGTGG - Intronic
1021624766 7:22582225-22582247 CAGATAGATGTCCCATGCTGGGG - Intronic
1023027302 7:36062297-36062319 CAGCAAGCTGGCTCCTGCTGCGG + Intergenic
1024976716 7:55120220-55120242 CAGCCTGCTCTCCAGTGTTGGGG + Intronic
1026154624 7:67816354-67816376 CAGCCTGCTGTGCTGTGCTGTGG - Intergenic
1027278836 7:76590863-76590885 AAGGCAGCTGTGCTGTGCTGGGG - Intergenic
1028236484 7:88368901-88368923 CTGCCAGCTGTACAGTGCTTGGG + Intergenic
1034677926 7:152904907-152904929 CAGCTCACTGTCCTGTGCTGTGG + Intergenic
1035237592 7:157508914-157508936 CAGCCAGGTGTACGGTGCAGAGG + Intergenic
1037987039 8:23296492-23296514 CAGCCTTCTGGCCTGTGCTGTGG + Intergenic
1042565180 8:70103729-70103751 CTGCCAGCTGTCCAGTGTTGCGG - Intergenic
1049009574 8:139878510-139878532 CTCCCAGCTGTGCAGTGCTGGGG + Intronic
1049210351 8:141383684-141383706 CAGCCTGCTGTCCTGGGCTCGGG - Intergenic
1049397277 8:142406863-142406885 CAGACCACTGTCCTGTGCTGGGG - Intergenic
1051433180 9:17001745-17001767 CAGCTAGCTCTTCAGTGCTGTGG + Intergenic
1051899850 9:22026127-22026149 CGGGCAGCTGTTCTGTGCTGGGG + Intronic
1056787111 9:89601236-89601258 CAGCCAGGTGTCCTCAGCTGGGG + Intergenic
1059061591 9:111038869-111038891 CTGCCAGCTGTCCGGCGCTGGGG - Intergenic
1059779168 9:117508305-117508327 AAGGCAGCTGTGCTGTGCTGGGG + Intergenic
1060806209 9:126578943-126578965 CAGCCAGTTGTCCCTAGATGCGG + Intergenic
1061610307 9:131741102-131741124 GAGCCACCTGTCCCGGGCTGGGG + Intergenic
1062178154 9:135175784-135175806 CAGCCAGCTGACCCTGGCTCTGG - Intergenic
1062217691 9:135398265-135398287 CAACCAACTGTCCTGGGCTGGGG + Intergenic
1186091400 X:6052570-6052592 CTGTCAGCTGTCCTGTGGTGTGG + Intronic
1186703617 X:12118425-12118447 CAGCCAGCAGTCGCCTGCTGCGG - Intergenic
1188005346 X:25012850-25012872 CAGCCCGCTGTCCCTCCCTGGGG + Intronic
1192960660 X:76127167-76127189 AAGGCAGCTGTGCTGTGCTGGGG - Intergenic
1195241905 X:102960474-102960496 AAGGCAGCTGTGCTGTGCTGGGG + Intergenic
1195361312 X:104085734-104085756 AAGGCAGCTGTACTGTGCTGGGG + Intergenic
1197023194 X:121716244-121716266 AAGGCAGCTGTGCTGTGCTGTGG + Intergenic
1199307133 X:146279787-146279809 CAGCTAGCTGTGCTGTGCTTGGG + Intergenic
1200135358 X:153872056-153872078 CAGCCAGTTGTCTCGTGGCGAGG - Intronic
1201985024 Y:19956818-19956840 CAGTCGGCTGTCCCCTGCTGGGG + Intergenic
1202596749 Y:26548357-26548379 AAGCCAGCTGTGCTGTGTTGTGG - Intergenic