ID: 1183455265

View in Genome Browser
Species Human (GRCh38)
Location 22:37919085-37919107
Sequence GGCTGCGCACGTGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183455265_1183455273 21 Left 1183455265 22:37919085-37919107 CCCCCAGCAGCACGTGCGCAGCC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1183455273 22:37919129-37919151 GTGCAGCGCTACCTGGCTGACGG 0: 1
1: 0
2: 0
3: 11
4: 92
1183455265_1183455274 25 Left 1183455265 22:37919085-37919107 CCCCCAGCAGCACGTGCGCAGCC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1183455274 22:37919133-37919155 AGCGCTACCTGGCTGACGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1183455265_1183455270 -1 Left 1183455265 22:37919085-37919107 CCCCCAGCAGCACGTGCGCAGCC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1183455270 22:37919107-37919129 CTGCCAGCAGCATGTGCACTTGG 0: 1
1: 0
2: 1
3: 26
4: 251
1183455265_1183455272 14 Left 1183455265 22:37919085-37919107 CCCCCAGCAGCACGTGCGCAGCC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1183455272 22:37919122-37919144 GCACTTGGTGCAGCGCTACCTGG 0: 1
1: 0
2: 1
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183455265 Original CRISPR GGCTGCGCACGTGCTGCTGG GGG (reversed) Exonic