ID: 1183455758

View in Genome Browser
Species Human (GRCh38)
Location 22:37922288-37922310
Sequence GGGGTGGGGCGGCCCGCAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 534}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183455758_1183455778 29 Left 1183455758 22:37922288-37922310 CCCCCTGCGGGCCGCCCCACCCC 0: 1
1: 0
2: 7
3: 61
4: 534
Right 1183455778 22:37922340-37922362 CCCCAGCACCCCCCACGCCCCGG 0: 1
1: 0
2: 5
3: 89
4: 907
1183455758_1183455765 -9 Left 1183455758 22:37922288-37922310 CCCCCTGCGGGCCGCCCCACCCC 0: 1
1: 0
2: 7
3: 61
4: 534
Right 1183455765 22:37922302-37922324 CCCCACCCCTGCCCCCAGGAAGG 0: 1
1: 2
2: 16
3: 112
4: 964

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183455758 Original CRISPR GGGGTGGGGCGGCCCGCAGG GGG (reversed) Exonic