ID: 1183455819

View in Genome Browser
Species Human (GRCh38)
Location 22:37922513-37922535
Sequence ACAATGGCACAGATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183455819_1183455825 -5 Left 1183455819 22:37922513-37922535 CCCCTCTCCATCTGTGCCATTGT 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1183455825 22:37922531-37922553 ATTGTGTGCTGTGCTGTGTTGGG 0: 1
1: 0
2: 1
3: 38
4: 303
1183455819_1183455826 -4 Left 1183455819 22:37922513-37922535 CCCCTCTCCATCTGTGCCATTGT 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1183455826 22:37922532-37922554 TTGTGTGCTGTGCTGTGTTGGGG 0: 1
1: 0
2: 8
3: 50
4: 380
1183455819_1183455827 15 Left 1183455819 22:37922513-37922535 CCCCTCTCCATCTGTGCCATTGT 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1183455827 22:37922551-37922573 GGGGCCTGCCTGTGTTTTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 297
1183455819_1183455824 -6 Left 1183455819 22:37922513-37922535 CCCCTCTCCATCTGTGCCATTGT 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1183455824 22:37922530-37922552 CATTGTGTGCTGTGCTGTGTTGG 0: 1
1: 0
2: 1
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183455819 Original CRISPR ACAATGGCACAGATGGAGAG GGG (reversed) Intronic
900596655 1:3483069-3483091 ACACGGGCTCAGCTGGAGAGGGG + Intergenic
900621907 1:3591378-3591400 ACAGTGGCACACATGGTGATCGG - Intronic
901130625 1:6960708-6960730 ACAATGACACAAAGGCAGAGTGG - Intronic
901337120 1:8460033-8460055 ACAATGACAAAGAGGGAGAGAGG - Intronic
903917565 1:26775256-26775278 ACAATGGACAAGATGGAAAGGGG - Intronic
904746705 1:32715907-32715929 ACAGTGGCAGAGGTGGAGAGGGG - Intergenic
905870769 1:41403297-41403319 GCAGTGACAGAGATGGAGAGAGG - Intergenic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
910028830 1:82690522-82690544 ACAAGGGCACAGATCCAGTGGGG - Intergenic
913241474 1:116834049-116834071 ACAATGGCAGAGAAGGAGGCTGG - Intergenic
914363542 1:146957577-146957599 ACGGTGGCACAGATGGAAGGTGG + Intronic
914488135 1:148129557-148129579 ACGGTGGCACAGATGGAAGGTGG - Intronic
914747008 1:150508454-150508476 GCAGGGGCACAGAAGGAGAGGGG + Intronic
915350071 1:155218715-155218737 AGCAAGGCACAGATGGAGGGAGG - Intergenic
915353469 1:155240953-155240975 AGCAAGGCACAGATGGAGGGAGG - Intronic
915763007 1:158334447-158334469 ACAATGGTACTAATGCAGAGTGG - Intergenic
916354931 1:163894403-163894425 TCTATTGCACAGATGGACAGAGG - Intergenic
917042924 1:170826289-170826311 GCAAAGGCATACATGGAGAGAGG - Intergenic
919416838 1:197321145-197321167 CCTATGGCACACATGGAGAATGG - Intronic
919477011 1:198041515-198041537 ACAAGGAGACAGATGGTGAGAGG + Intergenic
920806804 1:209242452-209242474 TCAATGACACAGAGGCAGAGAGG - Intergenic
920856158 1:209663926-209663948 AGGAGGGCACAGATGGACAGAGG + Intergenic
922262738 1:223957275-223957297 CCCATGGAGCAGATGGAGAGAGG - Intergenic
923258580 1:232244319-232244341 ACAAAGGCACACATGGACTGTGG + Intergenic
923355172 1:233147780-233147802 ACAATAACACATATGGAGATGGG + Intronic
924233269 1:241979757-241979779 ACAATGGCAGAGTCGGTGAGTGG + Intergenic
924504200 1:244665868-244665890 AGAATAGCCCAGATGAAGAGGGG - Intronic
1063510165 10:6636993-6637015 AGAATGGCAAACATGCAGAGGGG - Intergenic
1064250867 10:13705513-13705535 ACAATGGGTCAGATGCAGAAAGG - Intronic
1064633844 10:17344168-17344190 ACCATGGCAAAGATGCACAGAGG + Intronic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1065162063 10:22932848-22932870 ACAATGACACAGTTGGTAAGAGG - Intronic
1065434857 10:25695401-25695423 ACAAAGGAAGAGATGGTGAGAGG - Intergenic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1066482262 10:35808459-35808481 ACAATGGCAGAGATGAAAAGTGG - Intergenic
1066731755 10:38442796-38442818 CCCATGGAGCAGATGGAGAGAGG + Intergenic
1066984655 10:42454400-42454422 GCAAAGGCACAGATGGTGACAGG - Intergenic
1067251624 10:44591607-44591629 ACAAGGCCACAGATGCAGAAAGG - Intergenic
1067310977 10:45113331-45113353 AAAATAGAACAGATGGAGACAGG - Intergenic
1068252699 10:54464246-54464268 ACAAGGGCACAGTTGGGGAGAGG + Intronic
1068305123 10:55198832-55198854 ACAATGACAGAGCAGGAGAGAGG - Intronic
1068352979 10:55873298-55873320 ACATTGGCACAGATAGACACTGG - Intergenic
1069046726 10:63751047-63751069 AGAATGACACAGATGGGGAAAGG - Intergenic
1070096708 10:73344371-73344393 ACAATCTCAAAGTTGGAGAGAGG + Intronic
1070572300 10:77649625-77649647 ATAATGGCCCAGATGGCGATAGG - Intergenic
1070851161 10:79562552-79562574 AGAAGGGCACTGAAGGAGAGCGG - Intergenic
1071619802 10:87108899-87108921 GCAATGGCTCAGAAGGACAGAGG - Intronic
1071983978 10:91032350-91032372 ACAATGCAACAGAAGGAGACAGG - Intergenic
1073382487 10:103090128-103090150 AAATTGGAAAAGATGGAGAGGGG + Exonic
1073711445 10:106047340-106047362 GCAATGGACCAGATGAAGAGAGG - Intergenic
1074559743 10:114524778-114524800 ACAAGGGCACAGAAGGAAAAGGG + Intronic
1075131644 10:119745056-119745078 ACAATGCCAAAGATGGAAAAGGG + Intronic
1075474272 10:122719801-122719823 AAAAAGGCATAGAAGGAGAGAGG - Intergenic
1075770268 10:124928416-124928438 ACAGTTGCACAGTTGGGGAGGGG - Intergenic
1075882340 10:125864372-125864394 ACAAAGGCACCCATGGAGACAGG - Intronic
1076623676 10:131808847-131808869 ACAGAGGCACAGATAGAGGGAGG - Intergenic
1077300629 11:1845288-1845310 ACAGAGGCACAGAGGCAGAGAGG + Intergenic
1079499833 11:21090610-21090632 ACAATGCCATAAATGCAGAGAGG + Intronic
1079664834 11:23092410-23092432 GTAATGAGACAGATGGAGAGTGG + Intergenic
1080435613 11:32239382-32239404 ACAATGGCAGAGTTGAATAGCGG - Intergenic
1081988387 11:47324243-47324265 ACTGTGGCACAGGGGGAGAGTGG - Exonic
1082865270 11:57894441-57894463 ACCATGGCACAGCGGGAGAGGGG + Intergenic
1083736005 11:64681860-64681882 ACCATGCCAGAGAGGGAGAGAGG + Intronic
1085529191 11:77181644-77181666 CCAAGGGCACAGAAGGAGGGAGG - Intronic
1085858686 11:80206600-80206622 ACAATGGCCCACATGCAGTGGGG - Intergenic
1087494214 11:98868570-98868592 AAAGTGGGCCAGATGGAGAGTGG - Intergenic
1087579588 11:100035165-100035187 ACAATGGAACACATGGACACAGG - Intronic
1087609541 11:100417495-100417517 ACATTGGCTTATATGGAGAGGGG + Intergenic
1087757960 11:102074247-102074269 ACAATGGCACTGCTCCAGAGAGG - Intronic
1088312018 11:108470296-108470318 ACAATGTCACACATGAGGAGTGG + Intergenic
1088576749 11:111279581-111279603 ACAAAGACACAGATGCAGATGGG - Intronic
1089913748 11:122130677-122130699 ACACTGTCACAGATTGAGACTGG + Intergenic
1090187903 11:124750362-124750384 TCAATGGCAGAGAAGGGGAGTGG - Intronic
1091300630 11:134505008-134505030 ACTTTGGGAAAGATGGAGAGTGG - Intergenic
1091563421 12:1630762-1630784 AGAAGGGCGCAGATGGAGAGGGG + Intronic
1092103704 12:5905711-5905733 CCAATGGCACAGAGCCAGAGAGG + Intronic
1092940421 12:13402620-13402642 ACAATGGCCCAGAAGCAGGGAGG + Intergenic
1093466871 12:19458426-19458448 ACAATGGCAGACAAGGTGAGAGG - Intronic
1093890332 12:24512372-24512394 ACAATGGAAGGGATGGAGATAGG - Intergenic
1094269057 12:28590983-28591005 ACAATGGATCAGGTGGAGGGAGG - Intergenic
1094745624 12:33341351-33341373 AGTGTGGCACAGAAGGAGAGAGG - Intergenic
1094832350 12:34306150-34306172 AAAATGGCACGGAAGAAGAGGGG + Intergenic
1094833721 12:34312524-34312546 AAAATGGCACAGCTGAGGAGGGG - Intergenic
1095505362 12:42891476-42891498 ACAATTGAACTCATGGAGAGTGG - Intergenic
1097691538 12:62738929-62738951 ACTAGGGCACAGGTGGTGAGGGG - Intronic
1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG + Intergenic
1098174353 12:67775411-67775433 AGAATGTCACAGGTGGAGAGGGG + Intergenic
1099138714 12:78942431-78942453 AGAATTGGAAAGATGGAGAGAGG - Intronic
1099303420 12:80925909-80925931 AGAATGGAACAGATGGATAGAGG - Intronic
1101194280 12:102366813-102366835 AAAATGGGAAAGAGGGAGAGAGG - Intergenic
1101849613 12:108391818-108391840 ACTGAGGCAGAGATGGAGAGAGG + Intergenic
1102684239 12:114711987-114712009 ACAAAGACACAGAAGGACAGAGG - Intergenic
1102943201 12:116962052-116962074 TCACTGGTACAGAAGGAGAGGGG - Intronic
1102992194 12:117323048-117323070 GCAGGGGCACAGATGGAGAGAGG - Intronic
1103241073 12:119413820-119413842 GCACTGGCACATATGGAGTGGGG - Intronic
1103295318 12:119881390-119881412 ACACTGGCTCAGATGCAAAGTGG + Intergenic
1103402173 12:120650520-120650542 AGAACGGCACAGACGGAGGGAGG + Intronic
1103614543 12:122143660-122143682 ACAAAGGCACAGAAGTAGAGAGG - Exonic
1104454969 12:128903468-128903490 ACAAGGGCACGGATGCAGGGAGG + Intronic
1104463238 12:128971513-128971535 AGAAAGGGACAGAAGGAGAGAGG - Intronic
1105428150 13:20313492-20313514 AGGATGGCACAGATGGAAAAGGG + Intergenic
1106182308 13:27380316-27380338 AGAATGGCACACTTGGAGAGAGG + Intergenic
1107834925 13:44405319-44405341 AGAAAGGCAGAGAGGGAGAGGGG - Intergenic
1108420628 13:50245535-50245557 TCAATGGAACAAAAGGAGAGTGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1110446313 13:75585726-75585748 ACAATAGCACAAAGGGAGGGAGG + Intronic
1111428392 13:88120191-88120213 AAAATGGCAAAAATAGAGAGTGG - Intergenic
1112079955 13:95958971-95958993 ACAATGCCACTGATCCAGAGAGG + Intronic
1112126030 13:96469486-96469508 CCAATGGCAAGGATGGAAAGTGG - Intronic
1113011724 13:105775154-105775176 AGACTGGTAAAGATGGAGAGAGG - Intergenic
1113274033 13:108708044-108708066 ACAATTTCACAGAGGGTGAGGGG + Intronic
1113275377 13:108722782-108722804 ACAAGGACACAGAAGGTGAGTGG - Intronic
1113650043 13:112028262-112028284 AGGATGGCACAGAGGGTGAGAGG + Intergenic
1113852392 13:113425209-113425231 ACAATGGCATCCATGGAGTGGGG + Intronic
1115305290 14:31927690-31927712 ACTAGGGCAGAGATGGGGAGGGG - Intergenic
1115640803 14:35334502-35334524 GGGGTGGCACAGATGGAGAGAGG + Intergenic
1116581414 14:46646986-46647008 AATATGCCACAGCTGGAGAGTGG + Intergenic
1116814143 14:49568072-49568094 AGAAGGGTAGAGATGGAGAGAGG - Intergenic
1117741578 14:58824357-58824379 ACAATGGCTCAATTGTAGAGTGG + Intergenic
1119386453 14:74260511-74260533 AAAACGGCAAAGATAGAGAGAGG - Intronic
1120036307 14:79702474-79702496 ACAATTGGACAGGTGGTGAGAGG + Intronic
1120075748 14:80156345-80156367 ACAATTGCAATGATGGGGAGTGG - Intergenic
1121313177 14:92946053-92946075 CCAATGACGCAGGTGGAGAGAGG + Intronic
1122540056 14:102493133-102493155 ACAACGGGAATGATGGAGAGAGG - Intronic
1125340286 15:38668759-38668781 GGAATGGCAGAGATGGAAAGTGG + Intergenic
1125599964 15:40910083-40910105 ACACTGGCTCACATGGAGAGCGG - Intergenic
1126179083 15:45767470-45767492 ACAATGGAACACATGGACACAGG + Intergenic
1126686686 15:51254492-51254514 AAAATGGCAAAAATGGAGGGGGG - Intronic
1128768668 15:70266233-70266255 ACACTGGCAGAGATGGAGAGGGG - Intergenic
1129169796 15:73800666-73800688 AAAATCGCACAGAAGGAGGGAGG - Intergenic
1129371093 15:75096139-75096161 GCATTGGCACAGAGGGACAGAGG - Intronic
1129666737 15:77583362-77583384 ACCATGGCACATAGGCAGAGAGG - Intergenic
1131022199 15:89108369-89108391 ACAAAGACACAGATACAGAGGGG - Intronic
1131883215 15:96880894-96880916 AAGATGACACATATGGAGAGTGG - Intergenic
1132156019 15:99495633-99495655 ACAGGGACAGAGATGGAGAGGGG + Intergenic
1132257049 15:100384799-100384821 ACAAAGTCACAGATGGTGGGTGG + Intergenic
1133485289 16:6214165-6214187 ACAGTGGGAGAGAAGGAGAGAGG - Intronic
1133901477 16:9979323-9979345 AAAATGAGAAAGATGGAGAGTGG - Intronic
1134467978 16:14495811-14495833 ACAGAGGCACAGAAGGAGGGAGG + Intronic
1135023091 16:18978877-18978899 ACCATGGCTCAGAGGGAAAGTGG - Intergenic
1135707038 16:24684029-24684051 ACAATGGCAGAGTTGAATAGTGG - Intergenic
1135962659 16:27010692-27010714 ACAATGGCAGTGAAGAAGAGTGG + Intergenic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1138461062 16:57147875-57147897 AGAATGGCAAAGGTGGGGAGAGG - Exonic
1138536793 16:57664396-57664418 ACAAAGGCCCAGATGGACAGAGG - Exonic
1139327114 16:66161152-66161174 ACATTGGCCCAGATTGAGAAAGG - Intergenic
1139370916 16:66468965-66468987 ACAAAGGCACAGAAGGGTAGAGG - Intronic
1140813917 16:78603810-78603832 ACACTGAGTCAGATGGAGAGTGG - Intronic
1142683881 17:1565983-1566005 AGTGTGGCACAGCTGGAGAGTGG - Intergenic
1143861701 17:9896109-9896131 ACAATGTCAGAGATGGAAAGGGG - Intergenic
1143954167 17:10655980-10656002 ATAAGGGCACAGAGGGACAGGGG - Intronic
1145769005 17:27479107-27479129 ACAGGAGCACAGAGGGAGAGAGG - Intronic
1145950452 17:28812740-28812762 ACAAGGGGACAGAGGGAGAAGGG - Intronic
1147867808 17:43565032-43565054 CCCATGGCCCAGATGCAGAGAGG - Intronic
1148628435 17:49088311-49088333 ACCATGGCAGAGCAGGAGAGAGG + Intergenic
1148684368 17:49492836-49492858 GCAATGGCAGAGAGGGAGGGAGG + Intergenic
1148961603 17:51397847-51397869 AGAATGTCACAGATGACGAGAGG + Intergenic
1149545826 17:57503076-57503098 TCAATGGAACAGACGGAGATAGG - Intronic
1151061092 17:71095353-71095375 ACAATGAGACACATGGAGACAGG + Intergenic
1151551554 17:74825239-74825261 ACAGTGGCCCAGTTGGAGGGTGG - Intronic
1151672989 17:75582568-75582590 CCAAAGGCCCAGATGGAGAATGG - Intergenic
1152447550 17:80354646-80354668 CCCATGGCCCGGATGGAGAGAGG - Intronic
1152560377 17:81075698-81075720 AGAAGGGCACAGAGGGAGTGTGG - Intronic
1152994835 18:396875-396897 ACACAGGCAAAGGTGGAGAGTGG - Intronic
1153497513 18:5714931-5714953 ACAATACCAAAGTTGGAGAGAGG - Intergenic
1154323499 18:13372902-13372924 ACAAAGGCCCAGATGGTGAACGG - Intronic
1156030869 18:32710771-32710793 AGAAATGGACAGATGGAGAGGGG + Intronic
1156792304 18:40990363-40990385 ACAAAAGGAGAGATGGAGAGAGG + Intergenic
1157170830 18:45403579-45403601 GCAGTGGCACAGATGGAGCATGG + Intronic
1157290752 18:46407927-46407949 ACAGTGGCAAAGATCCAGAGAGG + Intronic
1160077558 18:75692994-75693016 ACGATTGCACAGCTGGGGAGTGG + Intergenic
1160360672 18:78274030-78274052 ACTATGGCACAGAGGTAGAAAGG - Intergenic
1160968467 19:1756998-1757020 ACAGTGGGAAAAATGGAGAGTGG - Intronic
1161248929 19:3270380-3270402 TCGGTGGGACAGATGGAGAGAGG + Intronic
1161744941 19:6050925-6050947 ACAAGGGCACAGATGATGACTGG + Intronic
1162334506 19:10052221-10052243 ACAATCGCAGTGATGGTGAGAGG - Intergenic
1162342925 19:10102674-10102696 GCAGTGGGACAGAAGGAGAGAGG + Exonic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1162865678 19:13544879-13544901 ACAATGGCAGAGATGGGAGGTGG - Intronic
1163783501 19:19262525-19262547 AGGATGACAGAGATGGAGAGAGG + Intronic
1164498394 19:28791633-28791655 ACAATGGTACATTTGCAGAGTGG - Intergenic
1164784460 19:30919116-30919138 AGCATGGCACAGTGGGAGAGAGG - Intergenic
1165903374 19:39179038-39179060 ACAATGGCTCAGGGGGAGAGGGG - Exonic
1166803412 19:45471364-45471386 ATAAGGGTACAGGTGGAGAGGGG - Intronic
1167393446 19:49211609-49211631 ACAGTGGCCCAGATGGACATGGG - Exonic
1167686398 19:50959504-50959526 ACAAAGGCACAGAGAGAGAATGG + Intronic
1168251604 19:55145445-55145467 AGAAAGGCAGAGATGGAGGGAGG - Intronic
926751710 2:16203504-16203526 AGAAAGACAGAGATGGAGAGAGG - Intergenic
927271515 2:21215176-21215198 ACGATGGCATAGAAGGAGAGGGG - Intergenic
927475303 2:23410052-23410074 AGCATGGCACAGGCGGAGAGTGG + Intronic
928307751 2:30184617-30184639 CCAACAGCACAGATGGAGAGAGG - Intergenic
928450559 2:31374715-31374737 ACAACTGCAGAGATGGAGTGTGG - Intronic
929119539 2:38473043-38473065 ATAAAGGCACAGAGGTAGAGAGG + Intergenic
929310573 2:40419541-40419563 ACAGGGGCAAAGATGGAGGGAGG - Intronic
931192738 2:60021349-60021371 AAAATGGTACAAATTGAGAGAGG + Intergenic
931245278 2:60487338-60487360 ACAATGCCACACACCGAGAGTGG + Intronic
931718454 2:65048202-65048224 TCAATTGCTCAGATGGAGATGGG - Intergenic
932409436 2:71536499-71536521 AGAGCGGCACACATGGAGAGCGG - Intronic
932438490 2:71717105-71717127 ACAATTGCACAGCTGGAGCAGGG - Intergenic
932537399 2:72614026-72614048 ACAAAAGCACAGTTGGATAGTGG + Intronic
933163231 2:79049643-79049665 ACAATTGAACATATGGATAGAGG + Intergenic
934121872 2:88847952-88847974 TCCAGGGCACAGATGCAGAGAGG - Intergenic
935093166 2:99916535-99916557 AGACTGGCAAAGATGGAGAGAGG + Intronic
935244795 2:101208827-101208849 AAGAGGGCACAGATGAAGAGAGG - Intronic
935487866 2:103680082-103680104 ACCATGGCAGAGCAGGAGAGAGG - Intergenic
935806722 2:106756121-106756143 AAAATGGGACATATGGTGAGGGG + Intergenic
937299593 2:120831112-120831134 AGAATGACACAGAAAGAGAGAGG - Intronic
939172377 2:138710921-138710943 ACATTAGCACAGATGCTGAGTGG - Intronic
940419147 2:153458106-153458128 ATAAAGTCACAGATGAAGAGAGG - Intergenic
942944211 2:181656218-181656240 ACAATGGCAAGGAAGGTGAGGGG + Intronic
945232222 2:207604391-207604413 ACAATTTAACAGATGGATAGTGG - Intronic
946226388 2:218266152-218266174 AGAGAGGCACAGATGAAGAGAGG + Intronic
946482884 2:220073794-220073816 ATAATAGCACAGATGGAAAGGGG + Intergenic
947384827 2:229580582-229580604 ATAAAGGAACAAATGGAGAGAGG + Intronic
948652965 2:239460126-239460148 ACACTGGCAGAGATGCATAGAGG + Intergenic
948671644 2:239572389-239572411 ACAATGGCAAAGATGGGGCCGGG - Intergenic
1169637480 20:7708330-7708352 ACAATGGAAGATAAGGAGAGGGG + Intergenic
1169785288 20:9353641-9353663 CCAGTGGCAGAGGTGGAGAGTGG - Intronic
1169852075 20:10063555-10063577 ACAAAGGCAAAGATGGAAAGGGG - Intergenic
1170021782 20:11844688-11844710 ACAATGGCAAAGAAAGAGAGAGG + Intergenic
1171137356 20:22708604-22708626 ACAATGGCACAGTTGGCCTGGGG + Intergenic
1172368714 20:34370280-34370302 ACAATGCCAGGGATGGAGACAGG - Intronic
1172557304 20:35853389-35853411 AGAATGCCACAGATGGAAAACGG - Intronic
1173178582 20:40784164-40784186 ACAATGGAGCAGATGTAGAAGGG - Intergenic
1173965495 20:47109526-47109548 ACCATAGCACAGAGGGAGAAAGG - Intronic
1174081201 20:47971893-47971915 ACAGAGGCACTGATGGAGAGAGG - Intergenic
1174135300 20:48374999-48375021 ACAGAGGCGCTGATGGAGAGAGG + Intergenic
1174136988 20:48386543-48386565 TCCAGGGCACAGCTGGAGAGGGG - Intergenic
1176666935 21:9696276-9696298 AAAATGGGACTGACGGAGAGGGG - Intergenic
1176834639 21:13781666-13781688 ACAATGGCACAGATGCCGTTGGG - Intergenic
1177974845 21:27835324-27835346 ACAATGCCACAGATGTACATTGG - Intergenic
1178164654 21:29959847-29959869 ACACTGGCTAAGATGGAGAAAGG - Intergenic
1178722420 21:35021848-35021870 CCAATGGGAGAGATTGAGAGAGG - Intronic
1179722687 21:43324559-43324581 ACAGAGGCACAGATGGGGAGAGG - Intergenic
1179840159 21:44067321-44067343 ACAAAGGCAGAGATGTAGTGTGG + Intronic
1180509692 22:16068140-16068162 ACAATGGAACACATGGACACAGG + Intergenic
1180878289 22:19185636-19185658 ACAAAGCCACAGATAGAAAGTGG - Intronic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1181946568 22:26522239-26522261 ACAGTCGCACAGTTGGAAAGTGG + Intergenic
1182837121 22:33351255-33351277 GCAAAGGCAGAGAGGGAGAGAGG + Intronic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1184147694 22:42620962-42620984 AGAGTGGCACAAATGGAAAGTGG - Intronic
1184233045 22:43168766-43168788 ACAACGGCCCAGATGGTAAGAGG - Exonic
1184978760 22:48081426-48081448 CCAATGGCACAGATGCCGAGAGG + Intergenic
949243233 3:1895337-1895359 GCTATGGGGCAGATGGAGAGGGG + Intergenic
949713322 3:6897883-6897905 AGAAAGGCACTGCTGGAGAGTGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950430796 3:12949801-12949823 GGGATGGCACAGCTGGAGAGAGG + Intronic
951628337 3:24691402-24691424 CAAATGGCGCAAATGGAGAGGGG - Intergenic
952533082 3:34282081-34282103 ACAGGGGCAAAGTTGGAGAGAGG - Intergenic
953322567 3:41985217-41985239 ACTATGGCACAGAACCAGAGTGG - Intergenic
954061655 3:48072760-48072782 AAAATGGCACAGAAGGGAAGTGG - Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954361199 3:50123785-50123807 TCACTGGCAGAGCTGGAGAGGGG + Intergenic
954367356 3:50153778-50153800 TCAATGGGTCAGAGGGAGAGAGG + Intergenic
954746884 3:52792388-52792410 ACAATGTCACAGGTGCAGGGAGG + Intergenic
958779160 3:98521191-98521213 ACAATGGCACAGTGGGATTGTGG - Exonic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
959674725 3:109021372-109021394 ACATCAGCAGAGATGGAGAGAGG - Intronic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
962336345 3:134534930-134534952 ACATGGGCACAGATGCAGATAGG - Intronic
962391300 3:134974988-134975010 AAAAGGGAAGAGATGGAGAGAGG - Intronic
964419352 3:156485365-156485387 ACAATGGCAAAGAACAAGAGAGG - Intronic
967012554 3:185450181-185450203 AAAATTGCACAGATAGAAAGGGG - Intronic
967147510 3:186618465-186618487 AAAAGGGCAGAGAAGGAGAGCGG - Intronic
968290011 3:197531929-197531951 ACACTGCCACAGGTGGAGACTGG - Intronic
970078746 4:12255240-12255262 ACATTTGCACAGATGGCCAGGGG - Intergenic
974006083 4:56558672-56558694 ATAACAGCTCAGATGGAGAGAGG - Intronic
975247004 4:72131102-72131124 CCAATGGCACAGCAGCAGAGTGG - Intronic
975681664 4:76883411-76883433 ACCATGGCAGAGCAGGAGAGAGG - Intergenic
976301970 4:83523843-83523865 ACCGTGGAAGAGATGGAGAGGGG + Intergenic
976927454 4:90516911-90516933 GCAATTGCACAAATGGAGTGGGG + Intronic
977783300 4:101004770-101004792 ACCATGGCAGAGCAGGAGAGAGG - Intergenic
977838312 4:101671192-101671214 ACAATTGCACAAAGGGAGAGAGG - Intronic
978292556 4:107161036-107161058 ATAATGTCAGAGATAGAGAGGGG + Intronic
979258140 4:118625423-118625445 CCCATGGAGCAGATGGAGAGAGG + Intergenic
979330206 4:119415145-119415167 CCCATGGAGCAGATGGAGAGAGG - Intergenic
980194345 4:129568745-129568767 AGAAGGGCTCAGATGGTGAGAGG - Intergenic
982130662 4:152225916-152225938 ACACAGGCCCAGATGGAAAGTGG - Intergenic
983309377 4:166038213-166038235 AGAAAGGCAGAGAAGGAGAGAGG - Intronic
983612347 4:169662468-169662490 ACAATGGAATTGATGGAGACAGG + Intronic
984478120 4:180263370-180263392 AGACTGGCACAGAGGGACAGTGG + Intergenic
985267975 4:188167638-188167660 ACGATGGCCCAGGAGGAGAGAGG + Intergenic
985345616 4:189001704-189001726 ACAGGGGCACACATGGAGTGAGG - Intergenic
985408077 4:189656072-189656094 AAAATGGGACTGACGGAGAGGGG + Intergenic
985507706 5:293371-293393 ATAATGTCAGAGATGGAGAAAGG + Intronic
986199087 5:5565146-5565168 ACCAGGGCAGAGATAGAGAGGGG + Intergenic
987442454 5:17972617-17972639 AAAATGGCACAGCTACAGAGAGG - Intergenic
988849027 5:35160310-35160332 ACAATGACACAGTTGGGTAGTGG + Intronic
991021525 5:61984435-61984457 AGAATTTCACAGATGAAGAGGGG + Intergenic
991515428 5:67429632-67429654 ACAATGCCCCAGAAGAAGAGAGG - Intergenic
992786987 5:80179533-80179555 ATAATGGCACAGGTGCAGTGAGG - Intronic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
995760306 5:115555212-115555234 ACAATGGCAGCTATGGGGAGTGG - Intergenic
996290026 5:121841836-121841858 ACGATGACACAGAAGGAAAGTGG - Intergenic
997601779 5:135143760-135143782 ACAATGGAACACATGGACACAGG - Intronic
997854666 5:137362688-137362710 ACAATGGCAGAGTTGAGGAGAGG - Intronic
998302791 5:141041135-141041157 ACAATGCCAGAGGTGGAGGGGGG - Intergenic
999779333 5:154836384-154836406 ACAATGCCCCAGATTCAGAGAGG + Intronic
1001097178 5:168784708-168784730 ACAAGAGCAAAGAAGGAGAGAGG - Intronic
1003850663 6:10219146-10219168 TCCATGGAAAAGATGGAGAGAGG - Intergenic
1006383770 6:33717305-33717327 ACTACGGAACAGATGCAGAGAGG - Intergenic
1006780056 6:36626518-36626540 ACAAGGGCACGTCTGGAGAGTGG + Intergenic
1006997587 6:38276295-38276317 ACAATGGAACACATGGACACAGG + Intronic
1008497823 6:52151058-52151080 CAAGTGGCACAGCTGGAGAGTGG - Intergenic
1008666572 6:53722800-53722822 GACATGGCACAGATGCAGAGAGG + Intergenic
1008948532 6:57127988-57128010 ACAATGGCACAGTTGAGTAGTGG + Intronic
1010065848 6:71681620-71681642 GCAATAGCAGAGATGAAGAGTGG - Intergenic
1010776807 6:79896211-79896233 ACAGTGGCAGAGATGGAGCAGGG - Intergenic
1011388103 6:86819603-86819625 ATTCTGGCACATATGGAGAGTGG - Intergenic
1011605153 6:89096314-89096336 ACAAGGAAACAGATGCAGAGAGG - Exonic
1011844029 6:91539718-91539740 ACAATGGCACAGTTGAATAATGG + Intergenic
1013284431 6:108668694-108668716 GCAAAAGCCCAGATGGAGAGGGG + Intronic
1015863654 6:137706126-137706148 ACAATGAAAGAAATGGAGAGAGG - Intergenic
1018002179 6:159589130-159589152 ACAAAGGTAGAGATGGGGAGAGG - Intergenic
1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG + Intronic
1019215120 6:170438563-170438585 ACACGGGCACAGATGGAGGGTGG - Intergenic
1019659562 7:2216444-2216466 TCAAGGGCTCAGAAGGAGAGAGG + Intronic
1020599450 7:10253787-10253809 ACAATGGAACACATGGACACAGG + Intergenic
1021426914 7:20510717-20510739 ACAATAGAAAAGATGAAGAGAGG - Intergenic
1022492973 7:30834896-30834918 ATAAGGTCTCAGATGGAGAGGGG - Intronic
1023504168 7:40882913-40882935 ACGAAGGAACAGATGGAGATGGG - Intergenic
1023856062 7:44185136-44185158 ACAATGAGACAGAGAGAGAGGGG + Intronic
1023991148 7:45129635-45129657 AGAAAGGCACAGACGGAGTGGGG - Intergenic
1025208815 7:57009207-57009229 ACCATGGCAGTGATGGAGAGGGG - Intergenic
1025663136 7:63567663-63567685 ACCATGGCAGTGATGGAGAGGGG + Intergenic
1027458824 7:78426403-78426425 ACAATGGAACACATGGACACAGG + Intronic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028031764 7:85924081-85924103 ACAATGGCAGAAATGGTGACAGG - Intergenic
1028515852 7:91677639-91677661 ACCCTGGCACAGATGGAGGTAGG + Intergenic
1028952276 7:96649945-96649967 ATGATGGATCAGATGGAGAGTGG - Intronic
1029670111 7:102024298-102024320 ACAAGGGCTCAGATTCAGAGGGG - Intronic
1030178733 7:106682397-106682419 ACAATGGCAGAGTTGAATAGCGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031177889 7:118375636-118375658 ACAATGGCACAGTTGGCTGGTGG - Intergenic
1032638946 7:133743450-133743472 ACAATGGCACAGCTGCTAAGGGG - Intronic
1033109735 7:138563415-138563437 ACACGGGCACAGACGGAGATGGG - Intronic
1034214948 7:149398060-149398082 ACAATGACACAGATGGCAGGAGG + Intergenic
1034417245 7:150971594-150971616 ACAATGGGAGAGAGGGAGAGAGG + Intronic
1035039593 7:155917804-155917826 ACAATGGCACCAGTGGGGAGAGG + Intergenic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036080036 8:5545133-5545155 ACAGAGGCACAGATGGGGAGTGG - Intergenic
1037769941 8:21792592-21792614 ACAAAGGCACAGTGGGAGAAAGG + Intronic
1038666134 8:29539821-29539843 ACAATGGAGCAGAGGGTGAGGGG - Intergenic
1039366373 8:36932329-36932351 AACATGGCATAAATGGAGAGAGG - Intronic
1040275905 8:46013545-46013567 AAAATGGCACAGCTGAGGAGGGG - Intergenic
1041338398 8:56813484-56813506 AAAATAGCACAGAGTGAGAGTGG + Intergenic
1042607933 8:70565334-70565356 ACATTGGGGCAGATGGGGAGGGG + Intergenic
1043787308 8:84419430-84419452 ATAATGGTACAGATGCAGAATGG - Intronic
1044794807 8:95885853-95885875 CCAATGGAACAGAAGGTGAGAGG + Intergenic
1047632136 8:126719682-126719704 ACAATGGCACTGCTGGTTAGCGG - Intergenic
1047664648 8:127077432-127077454 ACAATGGCACAGGTGACTAGTGG + Intergenic
1047774620 8:128059604-128059626 ACAATGGCAGAGATGACGAGGGG + Intergenic
1048055016 8:130854934-130854956 ACAAAGACACAGAAAGAGAGAGG - Intronic
1048067296 8:130983458-130983480 AGAATGGCAGAGAAGCAGAGAGG + Intronic
1049256567 8:141617257-141617279 ACAAAGGCGCAGATGGAGGCAGG - Intergenic
1050831028 9:10013216-10013238 ACAAGGCCACAGATGGACACTGG + Intronic
1051242235 9:15070827-15070849 ACAAAGGAACTGATGGAGACAGG - Intergenic
1054897190 9:70327963-70327985 ACCATGGCAGAGTAGGAGAGAGG + Intronic
1057394687 9:94669335-94669357 AAACTTGCACAGATGGGGAGGGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1057820679 9:98328163-98328185 ACCCTGGGACAGATGGAGACAGG - Intronic
1058115029 9:101075810-101075832 ACAGTGGTGTAGATGGAGAGTGG + Intronic
1058338063 9:103857926-103857948 AAAATGGCAAAGATGAAGAATGG - Intergenic
1059521340 9:114944933-114944955 ACTATGGCACGAAGGGAGAGAGG + Intergenic
1061375660 9:130222943-130222965 ACAATGGCAGGGATGGGGAGGGG + Intronic
1062009484 9:134259310-134259332 ACATTGGGGCAGATGGACAGTGG - Intergenic
1062275124 9:135726886-135726908 AGAATGGGAAAGAGGGAGAGAGG - Intronic
1203659162 Un_KI270753v1:25486-25508 AAAATGGGACTGACGGAGAGGGG + Intergenic
1203667527 Un_KI270754v1:28431-28453 ACAACTGCAAAGAGGGAGAGAGG + Intergenic
1203668675 Un_KI270754v1:34070-34092 ACAACTGCAAAGAGGGAGAGAGG + Intergenic
1187185268 X:16978470-16978492 ACAAGGGCACAGAAGGAGCATGG - Intronic
1187598574 X:20801551-20801573 ACCATGCTAAAGATGGAGAGAGG - Intergenic
1188618962 X:32195799-32195821 ACAACTGCACAGATAGAAAGAGG - Intronic
1190062911 X:47222509-47222531 GCAATGGCCCAAAGGGAGAGGGG + Intronic
1191872362 X:65759067-65759089 AAATTGGAACAGATGGTGAGGGG + Intergenic
1192493549 X:71597554-71597576 AGAGGGCCACAGATGGAGAGAGG - Intronic
1193256612 X:79355925-79355947 ACCATGGCAGAGCAGGAGAGTGG - Intergenic
1194616426 X:96109571-96109593 ACAGTTTCACAGATGAAGAGAGG - Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1195847151 X:109241132-109241154 AGAAAGGCAGAGAGGGAGAGAGG - Intergenic
1196042652 X:111222214-111222236 ACCTTGGCAAAGAAGGAGAGAGG - Intronic
1196134400 X:112191436-112191458 ACAAAGCCACAGATACAGAGTGG - Intergenic
1196292122 X:113955096-113955118 ATAGTGGCACAAATGTAGAGTGG - Intergenic
1197402012 X:126004759-126004781 ACAATTGAACATATGGAGATAGG - Intergenic
1197765570 X:130057441-130057463 ACAATGCCACAGAGGGGGCGGGG - Exonic
1198169509 X:134091871-134091893 ACCATGCCACAGGTGGACAGCGG + Intergenic
1199335601 X:146615776-146615798 ACTCTAGCACAGAAGGAGAGGGG - Intergenic
1200714605 Y:6523895-6523917 AAAGTGGGACAGAGGGAGAGAGG - Intergenic
1201019219 Y:9637263-9637285 AAAGTGGGACAGAGGGAGAGAGG + Intergenic