ID: 1183456641

View in Genome Browser
Species Human (GRCh38)
Location 22:37926597-37926619
Sequence GCCAAAAACTCCAGCGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183456641_1183456647 14 Left 1183456641 22:37926597-37926619 CCAGGAACGCTGGAGTTTTTGGC 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1183456647 22:37926634-37926656 AGTCTTCTGATACCCTGAGCTGG 0: 1
1: 0
2: 4
3: 24
4: 133
1183456641_1183456648 15 Left 1183456641 22:37926597-37926619 CCAGGAACGCTGGAGTTTTTGGC 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1183456648 22:37926635-37926657 GTCTTCTGATACCCTGAGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 206
1183456641_1183456649 22 Left 1183456641 22:37926597-37926619 CCAGGAACGCTGGAGTTTTTGGC 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1183456649 22:37926642-37926664 GATACCCTGAGCTGGGTTTTTGG 0: 1
1: 0
2: 2
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183456641 Original CRISPR GCCAAAAACTCCAGCGTTCC TGG (reversed) Intronic
902110346 1:14073283-14073305 GCCACAAACTCTAGTGTACCAGG + Intergenic
909081086 1:71112675-71112697 GCAAAAATCTCCAGAGTTCTAGG - Intergenic
910514443 1:88043923-88043945 GACAAAAATTCCAGTTTTCCTGG - Intergenic
912724406 1:112045814-112045836 GCAAAAAACACCAGGGTTGCTGG - Intergenic
912749610 1:112275427-112275449 GACAAAAACTCCAGGCTCCCTGG + Intergenic
913997703 1:143665090-143665112 GCCAATAACTCCAAGGATCCAGG - Intergenic
914508123 1:148307053-148307075 GCCAATAACTCCAAGGATCCAGG - Intergenic
916280025 1:163040196-163040218 GGCAAGAAATCCAGGGTTCCAGG - Intergenic
920854939 1:209654439-209654461 CCCAAGAACTCCAGGGCTCCAGG + Intergenic
921604921 1:217140645-217140667 GCCACAAACTCTAGGGCTCCGGG + Intergenic
924847738 1:247790007-247790029 GCCAGAAACCCCAGAGTTTCTGG - Intergenic
1063219700 10:3955708-3955730 AGCACAATCTCCAGCGTTCCAGG + Intergenic
1069547593 10:69339627-69339649 TCCAAAAACCCCAACGTTTCAGG - Intronic
1074752487 10:116600043-116600065 GCCACAAAGTCCCGGGTTCCTGG - Exonic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075999215 10:126902396-126902418 GCCACAACCTCCAGGGCTCCTGG + Intergenic
1076205443 10:128596782-128596804 GGCAAAAACTTCAGTGTTCTAGG + Intergenic
1078208376 11:9249902-9249924 GCCTCAAACTCCTGAGTTCCAGG + Intronic
1079762041 11:24341189-24341211 GCCAAATACCCAAGCGTCCCTGG + Intergenic
1081669898 11:44937064-44937086 ACAGAAAACTCCAGGGTTCCTGG + Intronic
1084574345 11:69979019-69979041 TCCAAAAACTCGAGCGATGCGGG + Intergenic
1084581213 11:70024593-70024615 GCCACAAACTCCAGCTTCCCAGG - Intergenic
1086852659 11:91828692-91828714 GCCAAATACCACAGTGTTCCAGG + Intergenic
1087659544 11:100970764-100970786 GCCAAAATCTCCCTCGTTTCAGG - Intronic
1088864328 11:113832851-113832873 GCCTCAAACTCCTGGGTTCCAGG + Intronic
1091060802 11:132460133-132460155 GCTGAAAACTCATGCGTTCCAGG + Intronic
1092292292 12:7168728-7168750 GCCAGAAATTCCAGAGTACCTGG - Intergenic
1097204874 12:57312388-57312410 GCCTCAAACTCCTGCGTTCAGGG + Intronic
1097334314 12:58365346-58365368 GCCAAAAAATTCAGACTTCCCGG + Intergenic
1103889452 12:124227861-124227883 GCCATAGACTCCAGCTTCCCCGG + Intronic
1105411529 13:20175272-20175294 TCCAAAAACTCCACCATTGCAGG - Intergenic
1111523738 13:89439802-89439824 GACAAAATCTACAGAGTTCCAGG + Intergenic
1116030006 14:39560211-39560233 ACCAAAATCTCCATTGTTCCTGG + Intergenic
1121805894 14:96822175-96822197 GACAAAAACTCCTGCCTTCATGG - Intronic
1125888718 15:43249696-43249718 GCCTAGAACTCCAGGGTGCCTGG + Intronic
1128562135 15:68675870-68675892 GACAAAAACCCCAGCCTTCATGG + Intronic
1133144475 16:3774085-3774107 GCTAAGAACTCCCGCGCTCCTGG + Intronic
1135956015 16:26956797-26956819 GCCAGAAGCTCCACCCTTCCAGG - Intergenic
1136619128 16:31416407-31416429 GCCCAGAGCTCCAGAGTTCCTGG + Intronic
1137706825 16:50541220-50541242 ATCAAAAACTTCAGCTTTCCTGG - Intergenic
1149604316 17:57914077-57914099 TCCAAAAAATCCCGCCTTCCAGG - Intronic
1150707906 17:67504175-67504197 CCCAACATCTCCAGCCTTCCAGG + Intronic
1151051969 17:70988360-70988382 GCCAATAACTTCAGAGTTCTCGG - Intergenic
1151475197 17:74341202-74341224 GCCACAGCCTCCAGCGTACCTGG - Intronic
1152023869 17:77796423-77796445 GCCCAAAGCTGCAGCGGTCCTGG - Intergenic
1154491759 18:14927697-14927719 CCCATAAACTCCAAAGTTCCTGG + Intergenic
1158078751 18:53563462-53563484 GCCAAAGACTCCACCTTTCTGGG - Intergenic
1162852856 19:13444694-13444716 GCCCAAAAAGCCAGGGTTCCTGG + Intronic
1164714507 19:30381559-30381581 CCCAAATCCTCCAGCGTGCCAGG - Intronic
1166154577 19:40901296-40901318 GACAAAAACTCCTGCCTTCAGGG + Intergenic
928937360 2:36693403-36693425 GATAAAAACTCCTGCCTTCCTGG + Intergenic
938389958 2:130897260-130897282 GCCAACAGCTCCAGCCTTTCCGG - Intronic
945438646 2:209850791-209850813 GCCACAAACCCCAGCTCTCCTGG - Intronic
945933694 2:215881732-215881754 GCCAAAAACTCCAGTGAATCTGG + Intergenic
947580381 2:231312483-231312505 GCCACAAACTCCTGCCATCCTGG - Intronic
1170608710 20:17894471-17894493 GCCTCAACCTCCAGGGTTCCAGG - Intergenic
1171295329 20:24012209-24012231 TCCAAAAACTCCAGCCTGCGTGG - Intergenic
1183456641 22:37926597-37926619 GCCAAAAACTCCAGCGTTCCTGG - Intronic
1185392364 22:50569500-50569522 GCCAAAGACACCTGTGTTCCTGG + Intronic
949716768 3:6941100-6941122 GTCAATAGCTCCAGCATTCCAGG + Intronic
950481477 3:13246957-13246979 GGCAAACAGGCCAGCGTTCCAGG - Intergenic
960180007 3:114564840-114564862 GCAAATAACACCAGCGTTGCAGG + Intronic
962587068 3:136852424-136852446 GCCAAAAACTCATCGGTTCCAGG - Intronic
963161087 3:142150632-142150654 GACAAAAACTCCTGCCTTCATGG + Intergenic
966629132 3:182052542-182052564 GCAGAAAACTCCAGCATTACAGG + Intergenic
967087931 3:186110628-186110650 GTCAACAGCTCCAGCGTGCCTGG - Intronic
968170312 3:196504387-196504409 GACTACAACTCCAGGGTTCCAGG + Intergenic
969920490 4:10534444-10534466 GCCAAAAACTAAGGCATTCCTGG - Intronic
971734845 4:30434426-30434448 GCAAAATACTCCAACATTCCAGG + Intergenic
977283682 4:95074347-95074369 GCAAACAAAACCAGCGTTCCAGG - Intronic
978713156 4:111809808-111809830 GACAACAACTCCAGAGTTCAGGG - Intergenic
989452323 5:41601131-41601153 GCCTAAAACTCAAGCCTTGCTGG + Intergenic
998355097 5:141528726-141528748 GCCAAAAGCACCAGCATTTCTGG + Exonic
998823736 5:146080575-146080597 CCCAAAAAATAGAGCGTTCCAGG + Exonic
1013400323 6:109788854-109788876 GCCAAAAACGCAACAGTTCCAGG - Intronic
1016335749 6:143003187-143003209 GGCAAAAATTCCAGCATTTCCGG + Intergenic
1017140022 6:151182070-151182092 GCAAAAAACTCCTGACTTCCAGG + Intergenic
1024196956 7:47068660-47068682 AACAAAAACTCCAGCAGTCCTGG - Intergenic
1025222960 7:57132085-57132107 GACAAAAACCCCAGGGTGCCAGG + Intronic
1027027123 7:74861245-74861267 GCCTCAAACTCCAGGGTTCAAGG + Intergenic
1027060629 7:75082855-75082877 GCCTCAAACTCCAGGGTTCAAGG - Intergenic
1029476751 7:100789548-100789570 GCCAGAAATCCCAGCGCTCCGGG + Intronic
1029909235 7:104126635-104126657 TCCAAATACTCCAGGGTCCCTGG + Exonic
1030061715 7:105627315-105627337 GCCACAAACTCCAGGGCTCAGGG + Intronic
1034979481 7:155467049-155467071 GCCGAAAACTGCAGCCTGCCAGG + Intergenic
1039907672 8:41798349-41798371 GCCAAAAATAACAACGTTCCTGG + Intronic
1044567822 8:93684158-93684180 TCTAACAACTCCAGCATTCCTGG + Intergenic
1059398439 9:114053607-114053629 GCCAAGAACTGCAGCGTTGAGGG + Exonic
1188630382 X:32350566-32350588 CCCAGAGACTCCATCGTTCCTGG + Intronic
1195853596 X:109308139-109308161 CCCAAAAACTCCAGAATCCCTGG - Intergenic
1196374678 X:115019940-115019962 GTGAAAAACTCCGGTGTTCCTGG - Intronic
1198302532 X:135345422-135345444 GCCAAAAACAGCACAGTTCCTGG + Intronic
1198739258 X:139823225-139823247 ACAAAAAACGCCAGCTTTCCCGG + Intronic