ID: 1183457401

View in Genome Browser
Species Human (GRCh38)
Location 22:37930248-37930270
Sequence CCCCACAAGCAAGTGCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183457401_1183457409 9 Left 1183457401 22:37930248-37930270 CCCGGGTGCACTTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1183457409 22:37930280-37930302 CCCACTGTCACCCCAGGATTAGG 0: 1
1: 0
2: 1
3: 19
4: 160
1183457401_1183457411 10 Left 1183457401 22:37930248-37930270 CCCGGGTGCACTTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1183457411 22:37930281-37930303 CCACTGTCACCCCAGGATTAGGG No data
1183457401_1183457416 24 Left 1183457401 22:37930248-37930270 CCCGGGTGCACTTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1183457416 22:37930295-37930317 GGATTAGGGGAGACTTTCAGAGG 0: 1
1: 0
2: 2
3: 18
4: 150
1183457401_1183457406 3 Left 1183457401 22:37930248-37930270 CCCGGGTGCACTTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1183457406 22:37930274-37930296 CCCTGTCCCACTGTCACCCCAGG 0: 1
1: 0
2: 0
3: 21
4: 336
1183457401_1183457412 11 Left 1183457401 22:37930248-37930270 CCCGGGTGCACTTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1183457412 22:37930282-37930304 CACTGTCACCCCAGGATTAGGGG 0: 1
1: 0
2: 2
3: 5
4: 125
1183457401_1183457417 30 Left 1183457401 22:37930248-37930270 CCCGGGTGCACTTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1183457417 22:37930301-37930323 GGGGAGACTTTCAGAGGCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183457401 Original CRISPR CCCCACAAGCAAGTGCACCC GGG (reversed) Intronic
900414164 1:2527523-2527545 CCCCACAGGCCTGTGCTCCCAGG - Intergenic
902220674 1:14962581-14962603 TCCCACAAGCAAGTGCTGCTGGG + Intronic
905347550 1:37321377-37321399 GTCCGCAAGCAAGTGCACCCTGG - Intergenic
905693839 1:39960878-39960900 CCACAGAAGCATGTGCACACAGG - Intronic
906675226 1:47688421-47688443 CCCCACAGGCAACCCCACCCCGG + Intergenic
914716222 1:150257205-150257227 CCACACAGGCACGTGGACCCAGG + Exonic
915925658 1:160017268-160017290 CCCCCCAAGCAATCCCACCCAGG + Intergenic
917452071 1:175155666-175155688 CTACAAAGGCAAGTGCACCCTGG - Intergenic
919657666 1:200213646-200213668 CGCCACGCGGAAGTGCACCCTGG - Intergenic
919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG + Intergenic
1065989204 10:30991416-30991438 CCCCACCAGCAAGTTGATCCAGG - Intronic
1070636704 10:78134427-78134449 ACCCACAAGCACCTGCCCCCAGG + Intergenic
1074298141 10:112209943-112209965 CTCACTAAGCAAGTGCACCCAGG + Intronic
1074720061 10:116256609-116256631 CCCCTCAAGCAGGTGCTCCCTGG + Intronic
1076105881 10:127823334-127823356 ACCCACAAGCATGTGCTCTCAGG - Intergenic
1076137623 10:128055908-128055930 CCCCACATGAAAGAGCACCCTGG + Intronic
1079586619 11:22133101-22133123 CCCCAAAAGCAATTGCAACAAGG + Intergenic
1080170513 11:29296527-29296549 CCCCAGAAGCAAATGAACCCAGG + Intergenic
1081077310 11:38693286-38693308 CCCTGCAAGCAGGTGCAGCCAGG - Intergenic
1082855424 11:57802034-57802056 CCCAAAAAGGAAGTGCACCTTGG + Exonic
1083332440 11:61905243-61905265 ACACACAAGCACGTGCACACAGG + Intronic
1083642244 11:64151737-64151759 CCCCACAAGCAAGTAATCTCGGG + Intronic
1083971619 11:66080304-66080326 CCCCACCAGAAAGCACACCCCGG - Intronic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1085663826 11:78394769-78394791 CCCAATAAGCAAGTGGACCAGGG + Intronic
1089540262 11:119185588-119185610 CCCCAAAATCAAGTGTGCCCTGG - Intronic
1091850520 12:3693314-3693336 CTCCACAAGCAAGCGCATCCAGG + Intronic
1101672694 12:106891297-106891319 CCCCACCAGGAAGAGCACTCTGG + Intergenic
1102027588 12:109722377-109722399 CCCCCCAAGCAACCTCACCCAGG - Intronic
1104722284 12:131051205-131051227 TCCCACAAGCACGAGCACCCCGG - Intronic
1105327348 13:19382440-19382462 CGCCACTCGGAAGTGCACCCTGG - Intergenic
1107288107 13:38819436-38819458 CCCCACAAGAAAGTGAGCACAGG + Intronic
1112406289 13:99123575-99123597 CCCCACAAGCAAGTGGGCTTAGG + Intergenic
1114824184 14:26057096-26057118 CCCCAGAAGCAAGAGCAGCATGG + Intergenic
1120848501 14:89147473-89147495 CCCCACAACCCACTGCAGCCAGG - Intronic
1122370583 14:101227002-101227024 ACCCACAGGCAGGCGCACCCAGG + Intergenic
1125113230 15:36058339-36058361 GCCCACAAGCAAGGGCACAGAGG + Intergenic
1126974198 15:54156209-54156231 CTCCAGAAGCAGGTGCACTCAGG + Intronic
1128470382 15:67946608-67946630 CCTGACAAGCAAATGCACCAGGG + Intergenic
1128796156 15:70468303-70468325 CCCCAAAAGAAAGTGGCCCCTGG + Intergenic
1131711672 15:95062440-95062462 AGCCACAGGCAAGTGCACACTGG + Intergenic
1132039572 15:98513567-98513589 CTCCTCCAGGAAGTGCACCCTGG - Intronic
1134626987 16:15729269-15729291 CCCCACAAGCAGATGGAACCAGG + Intronic
1135261062 16:20981305-20981327 ACCCACAAGCACGTGGACCCAGG + Intronic
1136651223 16:31673357-31673379 CACTACAAGCAAGTGTAGCCAGG + Intergenic
1137057800 16:35753795-35753817 CACCACATGCAGGTCCACCCTGG + Intergenic
1137617049 16:49854856-49854878 CCCCACAAACGCGCGCACCCCGG + Intronic
1138129974 16:54471303-54471325 CCCTCCCAGCAAGTGCACCAGGG + Intergenic
1139922563 16:70469198-70469220 CCCCACCAGGAAGTCCTCCCTGG - Exonic
1145976739 17:28988270-28988292 GCCCACTAGGAAGTGCCCCCAGG - Intronic
1146475968 17:33163064-33163086 CCCCACCAGAATGAGCACCCTGG - Intronic
1147162685 17:38577263-38577285 CTCCTCAAGCCAGTGCACACAGG + Intronic
1147217910 17:38911652-38911674 CCCCACTAGGAAGGGCACCAGGG - Intronic
1147635381 17:41960761-41960783 CACCACAAGAGAGTGCATCCAGG + Intronic
1150249590 17:63698568-63698590 GCCCACAAGGAGGTGGACCCCGG - Exonic
1151884819 17:76917311-76917333 CCCAACAAGAAAGTGAAGCCAGG - Intronic
1152185666 17:78855095-78855117 CCCCACATCCAAGGGCAGCCTGG - Exonic
1152366782 17:79860930-79860952 CCCCACATTCATGTCCACCCAGG + Intergenic
1152576607 17:81143933-81143955 CCACAACAGCAGGTGCACCCAGG + Intronic
1152878838 17:82804008-82804030 CCCCACAGGCAGGTGCACCCCGG - Intronic
1152878852 17:82804050-82804072 CTCTACAGGCAGGTGCACCCCGG - Intronic
1152924904 17:83082428-83082450 CCCCACAAGCATGTCCACCTGGG + Intronic
1155533233 18:26789277-26789299 CCACACATCCTAGTGCACCCTGG + Intergenic
1157621777 18:49021106-49021128 CCTCACAGGCAATTGCAGCCAGG - Intergenic
1160307313 18:77751867-77751889 CCCTACACACAAGTGCACCATGG + Intergenic
1160412983 18:78687620-78687642 CACCACACACAGGTGCACCCGGG + Intergenic
1160981006 19:1816605-1816627 CCCCACCAGCCAGTGCTTCCAGG - Intronic
1161668413 19:5590633-5590655 CCCCAGGAGCCAGGGCACCCTGG + Intronic
1162400973 19:10446424-10446446 CCCCACATGCCAGTTCCCCCAGG + Intronic
1163128892 19:15259662-15259684 ACCCACAAGCCAGTGGGCCCAGG + Intronic
1165065849 19:33227180-33227202 TCCCACCAGCACGTCCACCCTGG - Intergenic
1167898598 19:52601495-52601517 ACCCAAAAGGAAGTGAACCCCGG - Intronic
925426250 2:3751188-3751210 CCCCCAAAGCAACTGCTCCCGGG - Intronic
928180495 2:29065172-29065194 TCCCACAAGCCTGTTCACCCTGG + Intronic
930195510 2:48506009-48506031 CCCACAAAGCAAGTGAACCCAGG + Intronic
932330919 2:70897847-70897869 CCCCGCATGCACGTGCACCGGGG + Intergenic
932520936 2:72411554-72411576 CCCCACCACCAAGTGCACAGGGG - Intronic
935014976 2:99173264-99173286 CCTCAAAAGCCAGTGCCCCCAGG - Intronic
936998098 2:118436087-118436109 CCCCACAAGCGACTGAACTCTGG - Intergenic
937428334 2:121817891-121817913 GCCTACAAGAAAGTCCACCCTGG - Intergenic
947916796 2:233837860-233837882 CCCCACCAGCTTGTGCTCCCTGG - Intronic
948298653 2:236885246-236885268 CCCCACAAGCAAGGACAGGCAGG - Intergenic
948383346 2:237566721-237566743 CCCCAGAACCTAGTGCAGCCTGG + Intronic
948384756 2:237574605-237574627 CCCCAGAAGCAGGTGGGCCCAGG + Exonic
948838205 2:240636415-240636437 CCCCCCCACCAAATGCACCCTGG - Intergenic
1171986918 20:31666920-31666942 CCCCACAGGCTGCTGCACCCTGG - Intronic
1173983679 20:47244503-47244525 CCCCACAGCCTAGTGCAGCCTGG - Intronic
1174135680 20:48377388-48377410 CATCACAGCCAAGTGCACCCTGG + Intergenic
1179795951 21:43783617-43783639 TCCCACAGGCAAGTGCCCCGCGG - Intergenic
1181937346 22:26448423-26448445 CCACACAAGCCAGTCCAGCCTGG + Intronic
1183241380 22:36660301-36660323 CTCCACCAGCAACTGCCCCCCGG - Intronic
1183457401 22:37930248-37930270 CCCCACAAGCAAGTGCACCCGGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1185245443 22:49770652-49770674 CCCCACCAGCCAGTCAACCCAGG + Intergenic
949376944 3:3400984-3401006 CCTTACAAGCAAGTGCAGACAGG + Intergenic
949743637 3:7264122-7264144 CACTGCAAGCAAGTGCAGCCAGG + Intronic
950142834 3:10627249-10627271 CCAGACAAGCAAGTGGTCCCCGG + Intronic
951628467 3:24692709-24692731 CTCCACATGCATATGCACCCGGG + Intergenic
953384498 3:42498971-42498993 CCCCAAAAGAAGGTGCACCCTGG + Intronic
953876222 3:46668269-46668291 CCCCACCCACAACTGCACCCGGG - Intergenic
954138567 3:48593662-48593684 CCCCAGAGCCAAGTGCATCCAGG + Exonic
955887722 3:63618595-63618617 GCCTACAGGCAAGTGCAGCCTGG + Intergenic
964296552 3:155240102-155240124 CAGTACAAGCAGGTGCACCCAGG + Intergenic
965671711 3:171154421-171154443 CCCCAGAAGCACCTGCTCCCTGG - Intronic
965786435 3:172340137-172340159 CGTCAGAAGCAAGGGCACCCAGG - Intronic
971189539 4:24414269-24414291 GCCCAAAAGCAAATGTACCCAGG - Intergenic
975897182 4:79106881-79106903 CACTACAAGCAAGTGCATCCAGG + Intergenic
977303628 4:95297016-95297038 CCCCACCAGCATGTGTAACCAGG - Intronic
982099721 4:151955982-151956004 CCCCCCAAGCAAGTGATCCAAGG - Intergenic
984772219 4:183445376-183445398 CCCCATAAACAAGTGCCCCAGGG - Intronic
985569015 5:633778-633800 CCCCAGAGCCAAGTGCACCGAGG + Exonic
985672013 5:1211479-1211501 CCCAACAGTCAGGTGCACCCTGG - Intronic
988200830 5:28066544-28066566 CCCTGCAAGCAAGTGTAGCCAGG - Intergenic
990594759 5:57301574-57301596 CACCACATGCAAATGCACACTGG - Intergenic
992473414 5:77079515-77079537 CCCACCAAGCAAGTCCACTCCGG + Intronic
997758635 5:136423637-136423659 AGCCACCCGCAAGTGCACCCTGG - Intergenic
998948184 5:147363492-147363514 CTCCCCAAGCCAGTGCACTCTGG + Intronic
1001575794 5:172763166-172763188 CGCCACTCGGAAGTGCACCCTGG + Intergenic
1004766619 6:18735669-18735691 ATGCACAAGCAAGTGCACCTAGG + Intergenic
1006851767 6:37103495-37103517 CCCCACAAACAGGTGCAGCTGGG - Intergenic
1018143868 6:160864930-160864952 CAGCACAAGCAAGAGCACCTGGG + Intergenic
1018766654 6:166938856-166938878 CCCCACTGGGAAGTGCAGCCGGG + Intronic
1022553160 7:31261611-31261633 TCCCTCCAGCAAGTCCACCCAGG + Intergenic
1024214675 7:47238530-47238552 CCTCACAAGAAAGTGCTCCTGGG + Intergenic
1024526542 7:50354331-50354353 CCCCACTAGCCAGGGCAGCCTGG + Intronic
1025027517 7:55529430-55529452 CCCAACACACATGTGCACCCAGG + Intronic
1025255272 7:57380705-57380727 CCACACAAGCAAGAGCTCCTTGG + Intergenic
1026676906 7:72435715-72435737 CGGCACAAGCAAATGCACACAGG + Intronic
1027725841 7:81805017-81805039 CCCTACAAGCAACTGGACTCAGG + Intergenic
1027895645 7:84040428-84040450 AGCCACACGCAAGTGCACACTGG + Intronic
1030884281 7:114919781-114919803 CAGAACAAGCAAGTGCAGCCAGG + Intergenic
1031831630 7:126634427-126634449 CCCCACAGGCAAGTGAAACTTGG + Intronic
1035925342 8:3721986-3722008 CCCCACAAGCCAGTACACATGGG + Intronic
1037031637 8:14113590-14113612 CCACACAACCAGGTGAACCCGGG + Intronic
1040485606 8:47868821-47868843 CCCCAGCAGCAATTGCACGCAGG + Intronic
1048269450 8:133016999-133017021 CCTCACAAGCTGGGGCACCCAGG + Intronic
1048615085 8:136065339-136065361 CCTCACAAGCAACTGCAACTGGG + Intergenic
1049170468 8:141157532-141157554 CACCAGAAGCAAGTACAGCCCGG - Intronic
1055605769 9:77968916-77968938 TGCCACCAGCAAATGCACCCAGG + Intronic
1056594769 9:87998020-87998042 CCCCATAATCATGTCCACCCAGG + Intergenic
1056885699 9:90441764-90441786 CCCCACCAGACAGTGCACACTGG - Intergenic
1061496302 9:130976578-130976600 CCCCTCAGGGAACTGCACCCAGG - Intergenic
1062365734 9:136208152-136208174 CCCTCCAAGCAAGTGCTCCAGGG - Exonic
1062483848 9:136764564-136764586 GCCCAGGAGCAGGTGCACCCAGG - Intronic
1189331487 X:40147129-40147151 CCGCACATGCACGTGCACTCTGG + Intronic
1190911131 X:54773793-54773815 ACCCTCAAGCTAGAGCACCCTGG - Intronic
1191800458 X:65073436-65073458 CACTGCAAGCAAGTGCAGCCAGG + Intergenic
1192157695 X:68758799-68758821 CCCCACAGGCAGGGGCAACCGGG + Intergenic
1197482529 X:127004872-127004894 CCCTACAAGCAAGTGCTGCCAGG - Intergenic
1200084818 X:153598981-153599003 CGCCACTCGGAAGTGCACCCTGG + Exonic
1200756258 Y:6992635-6992657 CTCCTCCACCAAGTGCACCCTGG - Intronic