ID: 1183457999

View in Genome Browser
Species Human (GRCh38)
Location 22:37933148-37933170
Sequence CCTCCGTGTCACCAGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183457999_1183458006 -10 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458006 22:37933161-37933183 GACACGGAGGAGTGGGGGAGCGG 0: 1
1: 0
2: 6
3: 68
4: 711
1183457999_1183458013 27 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458013 22:37933198-37933220 AGTAGGATGCACAGGCAGACTGG 0: 1
1: 0
2: 1
3: 8
4: 212
1183457999_1183458015 29 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458015 22:37933200-37933222 TAGGATGCACAGGCAGACTGGGG 0: 1
1: 0
2: 4
3: 17
4: 192
1183457999_1183458007 -9 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458007 22:37933162-37933184 ACACGGAGGAGTGGGGGAGCGGG 0: 1
1: 0
2: 2
3: 40
4: 368
1183457999_1183458014 28 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458014 22:37933199-37933221 GTAGGATGCACAGGCAGACTGGG 0: 1
1: 0
2: 0
3: 18
4: 136
1183457999_1183458009 19 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458009 22:37933190-37933212 AAAACCCCAGTAGGATGCACAGG 0: 1
1: 0
2: 1
3: 9
4: 138
1183457999_1183458008 10 Left 1183457999 22:37933148-37933170 CCTGGGGCCTGGTGACACGGAGG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1183458008 22:37933181-37933203 CGGGCAGACAAAACCCCAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183457999 Original CRISPR CCTCCGTGTCACCAGGCCCC AGG (reversed) Intronic
900119476 1:1042337-1042359 CCTCTGCCTCACCAGCCCCCAGG - Intronic
900937048 1:5772921-5772943 CCTCCGTGTTTCCAGTCACCTGG - Intergenic
901428410 1:9198069-9198091 CCTCTCTGGCCCCAGGCCCCTGG + Intergenic
901815275 1:11790116-11790138 CGTCCATGGCACCAGCCCCCTGG - Exonic
904043184 1:27595783-27595805 CCTCCCTGACACCAGGAACCTGG - Intronic
905873554 1:41418309-41418331 CCTCCGGGTCACTACCCCCCAGG - Intergenic
906566854 1:46807008-46807030 CCTCCTTCTTACCAGGCTCCCGG + Intronic
907510413 1:54953914-54953936 CCTCCTTGTCTCCTGGCCCAAGG + Intergenic
908776215 1:67642956-67642978 GCTCTGTGTCACTAGGGCCCTGG + Intergenic
911165801 1:94723540-94723562 CCACCCTGGCTCCAGGCCCCAGG - Intergenic
913610897 1:120508921-120508943 CCTACGTGTCACCTGTCCCAGGG + Intergenic
914580293 1:149013318-149013340 CCTACGTGTCACCTGTCCCAGGG - Intronic
915626573 1:157117696-157117718 CCTCACTGTCTCCAGACCCCTGG - Intergenic
917787549 1:178475033-178475055 CCTCCTTTTCACCAAGTCCCAGG + Intronic
918463031 1:184795419-184795441 CCTCCCTGTCCCGAGGCCCATGG - Exonic
919452533 1:197788260-197788282 CCTCTGTTGCCCCAGGCCCCAGG - Intergenic
919896395 1:202012174-202012196 CCTCAGTGAGTCCAGGCCCCTGG + Exonic
920836087 1:209512568-209512590 TCTCCATGTCCCCAGGCCCAGGG + Intergenic
922853010 1:228750150-228750172 CCTCCATGTCACCAGCCACATGG + Intergenic
923854741 1:237834155-237834177 CCTCAGAGTCACCAGGCACCTGG + Intergenic
1063080199 10:2760677-2760699 ACTCAGTTTCATCAGGCCCCAGG - Intergenic
1063112938 10:3052676-3052698 ACCCCGTGTCGCCAGGCCCCAGG + Intergenic
1065093147 10:22253625-22253647 TGTGCGTGTCACCCGGCCCCGGG + Intergenic
1067744612 10:48926247-48926269 CCTCCATGGCCCCAGGCCCCAGG + Intronic
1068905516 10:62317441-62317463 CCTCCGTCTCACCGAGCCTCAGG - Intergenic
1069676380 10:70251595-70251617 GCTCAGTGTCAACAGGCCTCTGG + Exonic
1070325285 10:75384830-75384852 CCTCCCTGTCCCCAGCCCCCTGG + Intergenic
1070845688 10:79521256-79521278 TCTCCTGGTCACCAGGCCCCTGG - Intergenic
1070928105 10:80239058-80239080 TCTCCTGGTCACCAGGCCCCTGG + Intergenic
1072506510 10:96073141-96073163 CCTCCCTGTATCCAAGCCCCTGG + Intergenic
1073146675 10:101285913-101285935 CCTCCCTCCCCCCAGGCCCCAGG + Intergenic
1073538615 10:104300102-104300124 CCTCGGTGTCTCCAGGCCCATGG - Intronic
1073683213 10:105727391-105727413 TCTCCCTGTCTCAAGGCCCCTGG - Intergenic
1074413023 10:113244015-113244037 TCTCTGTGTCCCCAGGCCTCTGG + Intergenic
1074544699 10:114393571-114393593 CCTCCCTGTCCCCAGCCTCCAGG - Intronic
1076241926 10:128915287-128915309 CCACTGTGTGACCAGGGCCCAGG - Intergenic
1076892343 10:133291370-133291392 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1076892373 10:133291464-133291486 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1076892403 10:133291558-133291580 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1076892433 10:133291652-133291674 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1076892463 10:133291746-133291768 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1076892528 10:133291946-133291968 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1076892696 10:133292467-133292489 CCTCCGTGTCCCCGTGTCCCGGG + Intronic
1077412333 11:2409455-2409477 TCTCTGGGTCTCCAGGCCCCAGG - Intronic
1078080649 11:8202372-8202394 CCTCTGTGTTACGAGGCCCTAGG + Intergenic
1078196536 11:9141511-9141533 CAGCCCTGTCACCAGCCCCCAGG + Intronic
1078832127 11:14987828-14987850 CAGCTGTGTCACCAGCCCCCAGG - Intronic
1079124584 11:17709579-17709601 CCACCCTGTTTCCAGGCCCCAGG - Intergenic
1081646085 11:44791630-44791652 CCCCTGTGTCCCCAGGCTCCAGG + Intronic
1081993462 11:47349742-47349764 TCTCCGTGTCTCCACGACCCCGG + Intronic
1083651670 11:64207992-64208014 CCCCCGTGTCACTAGCCCCGTGG - Intronic
1083726358 11:64630566-64630588 CCTCCATGTCCCCAGGACCAGGG - Exonic
1083856179 11:65394150-65394172 CCTCCCTGTCCCTAGACCCCTGG + Intronic
1083869329 11:65477392-65477414 CCGCCGGGTCTCCAGCCCCCAGG + Intergenic
1084266708 11:68008763-68008785 CCTCCGTAGCTCCCGGCCCCGGG - Intronic
1089271281 11:117303169-117303191 CCTTCCTCTCACCTGGCCCCTGG + Intronic
1089730621 11:120516638-120516660 CCTCACTGTCACCAGCGCCCAGG - Intronic
1090482153 11:127078255-127078277 CCCCCGTGACACCAAGCCCATGG - Intergenic
1091761863 12:3092910-3092932 CCTCCCTGCCACCACGCCCAGGG + Intronic
1092195591 12:6548023-6548045 CCTCTGGGACACCACGCCCCTGG + Intronic
1092406900 12:8227673-8227695 TCTCCGTGCCACGTGGCCCCAGG - Intergenic
1093094594 12:14958234-14958256 CCTCCATGTCACCAGGGACAGGG - Intronic
1096618447 12:52847758-52847780 CCTCCGCGTCCCCATTCCCCAGG - Intronic
1096839178 12:54370302-54370324 CCTCTGCTTCACCCGGCCCCCGG - Exonic
1099428574 12:82553537-82553559 CCTCTGTGACACCAGGCATCAGG - Intergenic
1102014611 12:109639560-109639582 CCTCCGTGTCTCTGGGCCCTCGG - Intergenic
1102029986 12:109734785-109734807 CCTCCATGTCATCCGGCCACAGG - Intronic
1102472562 12:113167900-113167922 CCTGCCTGTCACTGGGCCCCTGG + Intronic
1103243195 12:119432195-119432217 CCTACATGTCACCAGTCCCTGGG - Intronic
1103700324 12:122845822-122845844 CACCCGTGTCCCCAGGCCCTAGG - Intronic
1104597849 12:130132134-130132156 TCACCGTGTCTCCAAGCCCCTGG + Intergenic
1104854756 12:131896385-131896407 CCTCCGTGTCCCGGGGCCCAGGG + Intronic
1108580305 13:51822596-51822618 CCTCCCTGCCACCTGGCCCCTGG - Intergenic
1108591315 13:51915599-51915621 CGCCCCTGTCACCATGCCCCTGG + Intergenic
1109207308 13:59496887-59496909 CCTCCCACTCTCCAGGCCCCGGG + Intergenic
1109367188 13:61370744-61370766 CCTGTGAGTCATCAGGCCCCAGG - Intergenic
1111635032 13:90892714-90892736 CCCTCGGGTCACCAGGGCCCTGG + Intergenic
1113986911 13:114324756-114324778 CCGCTGTGTCACCAGGCTCTTGG + Exonic
1114085953 14:19237069-19237091 CCTAAGTGTCACCAGGCACTAGG + Intergenic
1115539770 14:34409720-34409742 CCTCCATGACCTCAGGCCCCAGG + Intronic
1117403777 14:55381950-55381972 GCTGCTTCTCACCAGGCCCCTGG + Exonic
1117989319 14:61418292-61418314 CCTCCTTATCACCAGGACACAGG - Intronic
1119520161 14:75279152-75279174 CCTCCGCGACCCCAAGCCCCCGG - Intronic
1119549656 14:75499246-75499268 ACTGCGGGTCACCAGGCCCAGGG - Intergenic
1122891057 14:104732457-104732479 CCTGCGGATCAGCAGGCCCCAGG + Intronic
1122952126 14:105050832-105050854 CCTCCGTGACCACTGGCCCCAGG - Exonic
1123429319 15:20201401-20201423 CCTCCCTGACTCCTGGCCCCTGG - Intergenic
1123795220 15:23764054-23764076 CCTCCATGTCCCCAAACCCCTGG + Intergenic
1127269418 15:57387319-57387341 CCTCAGTGTCATCAGGCCTGTGG + Intronic
1128186157 15:65644944-65644966 CTTCTGTGACACCAGACCCCTGG - Intronic
1129700174 15:77763303-77763325 CCTCCTCCTCTCCAGGCCCCAGG - Intronic
1131615984 15:94017882-94017904 CCTCCATCTCATCAGGCCTCAGG - Intergenic
1132650201 16:1017789-1017811 GCTCCGTGTCACCAGCCACCCGG - Intergenic
1132808760 16:1787810-1787832 CCTCGTGGTCACCACGCCCCAGG + Exonic
1133399073 16:5471582-5471604 CCTCTGTCTCTCCAGGCACCAGG + Intergenic
1134167583 16:11942753-11942775 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1134493118 16:14710959-14710981 TGTCCTGGTCACCAGGCCCCTGG + Intronic
1134498499 16:14750083-14750105 TGTCCTGGTCACCAGGCCCCTGG + Intronic
1134525051 16:14936713-14936735 TGTCCTGGTCACCAGGCCCCTGG + Intronic
1134547844 16:15124206-15124228 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1134582077 16:15379002-15379024 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1134712641 16:16335200-16335222 TGTCCTGGTCACCAGGCCCCTGG + Intergenic
1134720505 16:16378515-16378537 TGTCCTGGTCACCAGGCCCCTGG + Intergenic
1134946922 16:18333370-18333392 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1134954186 16:18373493-18373515 TGTCCTGGTCACCAGGCCCCTGG - Intergenic
1135313010 16:21420405-21420427 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1135365934 16:21852685-21852707 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1135445881 16:22518477-22518499 TGTCCTGGTCACCAGGCCCCTGG + Intronic
1136169793 16:28482116-28482138 CATCCGTTTCACCTGGGCCCTGG - Exonic
1136287898 16:29254828-29254850 TCTCCCTGTCTCCCGGCCCCCGG + Intergenic
1136323123 16:29500913-29500935 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1136437807 16:30240881-30240903 TGTCCTGGTCACCAGGCCCCTGG - Intronic
1136854999 16:33648331-33648353 CCTCCCTGACTCCTGGCCCCTGG + Intergenic
1137285624 16:47013940-47013962 CCTCCCTTTCTCCAGGCCCCAGG + Intergenic
1139857362 16:69991512-69991534 CGTCCTGGTCACCAGGCCCCTGG - Intergenic
1139950341 16:70665255-70665277 CCTCAGTCCCACCAGGCCCAGGG + Intronic
1141230530 16:82162983-82163005 CCTCCCTGTGACCCTGCCCCTGG + Intronic
1141700552 16:85640195-85640217 CCTCCTTGTCACCAGCCCGGTGG + Intronic
1142093557 16:88227547-88227569 TCTCCCTGTCTCCTGGCCCCCGG + Intergenic
1142213269 16:88818409-88818431 CCTGCCTGTGACCAGGACCCGGG + Intronic
1142257335 16:89020348-89020370 CCTCCTTGTAACCACGCCCCTGG - Intergenic
1203116578 16_KI270728v1_random:1496816-1496838 CCTCCCTGACTCCTGGCCCCTGG + Intergenic
1142481961 17:224467-224489 CCTCCGTCTCACCTGTGCCCTGG + Intronic
1143538869 17:7558012-7558034 CCTCCATGCCTCCAGCCCCCAGG + Intronic
1143732532 17:8889108-8889130 CATGGGTGTCACCAGGGCCCCGG + Intronic
1144466919 17:15504320-15504342 CCTCTGTGTCACCAAACCCCAGG - Intronic
1147141959 17:38465144-38465166 CCGCCGTCTCCCCAGGCTCCCGG - Intronic
1147664530 17:42138244-42138266 CCTCTGTGTGACCAGGCCTATGG + Intronic
1147722391 17:42547178-42547200 CCAACATGTCCCCAGGCCCCTGG + Intergenic
1148062226 17:44844763-44844785 CTTCCGTTTAACCAGCCCCCTGG + Intergenic
1148690514 17:49524409-49524431 CCGCCGTCTCAGGAGGCCCCAGG - Intergenic
1149087734 17:52739372-52739394 CCTCCTTGACACAAGGCCACTGG + Intergenic
1150226669 17:63528220-63528242 TCCACGTGTCACCATGCCCCAGG + Intronic
1151227160 17:72655941-72655963 CCTCCACGCCACCAGCCCCCCGG - Intronic
1151490681 17:74431031-74431053 CCTCCGCGTCTCCAGGGCCCTGG + Exonic
1151929011 17:77219120-77219142 CCTCCGTGTCCCCAGGCTCCAGG - Intergenic
1152122886 17:78429449-78429471 CTTCAGGGTCACCAGGCCCCAGG + Intronic
1152286160 17:79414484-79414506 GCCCCGTGTGTCCAGGCCCCAGG + Intronic
1152584744 17:81183863-81183885 CCTCCGTGCCACCAGCCCAGAGG - Intergenic
1152728466 17:81958988-81959010 CCTCTGTGTCCCCAGGCACAGGG - Exonic
1152797834 17:82316662-82316684 CCTACCTGTCACCAGGACCAGGG + Exonic
1153562775 18:6388016-6388038 GCTCAGAGTCACCAGGCCCAAGG + Intronic
1153633624 18:7095497-7095519 CCTTCCTGTCTCCAGCCCCCAGG + Intronic
1154118809 18:11634760-11634782 TGTCCTGGTCACCAGGCCCCTGG - Intergenic
1157728611 18:49984665-49984687 CCTCCGTGCCATCAGCCCTCGGG + Intronic
1159851890 18:73534790-73534812 CCTCAGTGTCACCAAGTCCAGGG - Intergenic
1159938702 18:74389088-74389110 CCTCCCTGCCAGCAGGGCCCAGG + Intergenic
1160021748 18:75186707-75186729 CCCCCGTGTCTTCAGCCCCCTGG - Intergenic
1160680375 19:409277-409299 CCTCCCTGCCACCAGCCTCCGGG - Intergenic
1160688477 19:448656-448678 CCTTCGTGTCAGGAGGCCCCCGG - Intronic
1160699365 19:498530-498552 CCTCCGGGTCACCAGGCACCAGG - Exonic
1162535902 19:11262608-11262630 CCTCAGTTTCCCCAGCCCCCAGG - Intergenic
1162788636 19:13051782-13051804 AATCTGTGTCAACAGGCCCCAGG + Intronic
1162805808 19:13137456-13137478 CCTCCATGTCCCCTGCCCCCAGG + Exonic
1162817970 19:13207674-13207696 CCGCCGTGTCGACAGGCCCTGGG + Exonic
1163663031 19:18589704-18589726 CCGCCGTGTCTCTAGGACCCTGG + Intronic
1164989428 19:32673762-32673784 CCTGGGTGACAGCAGGCCCCGGG + Intronic
1165823774 19:38693856-38693878 CCTCCGTGTGCCAAGGCCCATGG - Intronic
1165988774 19:39793464-39793486 CCTCTGCCTCCCCAGGCCCCTGG - Intergenic
1166320663 19:42016660-42016682 CCTCCATGTGTCCAGCCCCCTGG - Intronic
1167085421 19:47306517-47306539 CCTCGGTGTCCCCATGCCCTGGG + Intronic
1167386864 19:49168573-49168595 CCTCCGGGTCACCGCGCCACCGG - Exonic
1167605808 19:50480820-50480842 CCTCAGGGTCTCCAGGTCCCTGG + Intronic
1168640603 19:58029063-58029085 CATCTGTGTCCCCAGCCCCCAGG - Intergenic
925289171 2:2735408-2735430 CCTCCCTGTCACCATCCCTCAGG - Intergenic
927719354 2:25372976-25372998 CCTCCTTCTCAGCAGGCCCAGGG + Intergenic
928089474 2:28365253-28365275 CCTCCCTCTCTCCAGGCTCCTGG - Intergenic
928537065 2:32251236-32251258 CCTCCGTCTCAGCAGGGCCCAGG - Exonic
931244379 2:60480168-60480190 CCTTCATGTCCCCAGCCCCCTGG - Intronic
932904037 2:75730696-75730718 CCTTCCTGTGACCAGGACCCAGG - Intergenic
932950570 2:76288440-76288462 CTTCCCTGTCACAAGGCACCAGG + Intergenic
934564171 2:95329380-95329402 CCTCTGGACCACCAGGCCCCAGG + Intronic
934735345 2:96687177-96687199 CCGCCTTGCCACCTGGCCCCTGG + Intergenic
937333668 2:121047459-121047481 CCACCTTGTCACCAGGGACCGGG + Intergenic
939143112 2:138379250-138379272 CCTCCATGGCCCCAGACCCCAGG + Intergenic
939176430 2:138753298-138753320 CCTCACTGTCACAAGGACCCAGG - Intronic
941182636 2:162278860-162278882 CCTTCCAGTCACCATGCCCCAGG - Intronic
943940550 2:193988915-193988937 CCTCAGTGTCAACAGGCCAATGG + Intergenic
947596101 2:231412548-231412570 CCTCAGCGTCACGATGCCCCCGG - Intergenic
948462842 2:238138675-238138697 CCTCCGTGTCCCCTGGCTGCCGG + Intergenic
948909877 2:240997815-240997837 CCTCTATGTCCCCAGGCCCATGG - Intergenic
949035085 2:241812512-241812534 CCTCAGTGTGACCAGTTCCCTGG - Intronic
949035113 2:241812632-241812654 CCTCCATGTGGCCAGGCCCTGGG - Intronic
1169255046 20:4090866-4090888 CCACCATGTAGCCAGGCCCCAGG + Intergenic
1170376697 20:15708343-15708365 CCTCCCTATCCCCAGGCTCCTGG - Intronic
1170567272 20:17614365-17614387 CCTCCCTGTCCCCCAGCCCCAGG - Intronic
1171035866 20:21712806-21712828 CCTCCGTTTGACCCAGCCCCGGG + Intronic
1172949103 20:38710928-38710950 CCAGCCTGTCACCAGGCTCCAGG - Intergenic
1174419783 20:50391902-50391924 CCTCCCTCTCATAAGGCCCCTGG - Intergenic
1175242845 20:57562559-57562581 CCTGCTGGTCACCAGCCCCCTGG - Intronic
1175917605 20:62434043-62434065 CCTCCCCGACACCAGGCTCCTGG - Intergenic
1176120979 20:63454494-63454516 CGGCCGTGGCTCCAGGCCCCAGG + Intronic
1176186830 20:63784846-63784868 CCTCAGGGTCACCAGGGGCCGGG + Intronic
1176228740 20:64019520-64019542 CCTCCCGGACACCAGGGCCCTGG + Intronic
1178139885 21:29670668-29670690 CCTCTGTTACAACAGGCCCCTGG + Intronic
1178438025 21:32576347-32576369 CCGCCTTGTCACAAGGTCCCTGG + Intergenic
1179902979 21:44403280-44403302 CCTCCCTAGCCCCAGGCCCCAGG - Intronic
1179929421 21:44557591-44557613 CCTCAGCGTCTCCAGGCCCCGGG - Intronic
1180292016 22:10856124-10856146 CCTAAGTGTCACCAGGCCCTAGG - Intergenic
1180494820 22:15885546-15885568 CCTAAGTGTCACCAGGCCCTAGG - Intergenic
1180964497 22:19779361-19779383 CCTCCCAGCCACCAGGCCCTGGG - Intronic
1181405639 22:22683458-22683480 TCTCCGTGTTGCCAGGGCCCTGG - Intergenic
1181684498 22:24519299-24519321 CCTTCGTGTCAGCAGGCACCTGG - Intronic
1182765309 22:32753864-32753886 GCTCCGTGAGAGCAGGCCCCTGG - Intronic
1183456426 22:37925654-37925676 CCTCCAGGACACCAGCCCCCAGG + Exonic
1183457999 22:37933148-37933170 CCTCCGTGTCACCAGGCCCCAGG - Intronic
1183674462 22:39291818-39291840 CCACTGTGTCCCCAGGGCCCAGG - Intergenic
1184118367 22:42434941-42434963 CCTCCGTGAGGCCAGGGCCCAGG - Intergenic
1184369825 22:44075181-44075203 CATCCATGTCTCCAGGGCCCAGG - Intronic
1184642593 22:45880344-45880366 CCTCCTAGTGTCCAGGCCCCAGG + Intergenic
1185175024 22:49321529-49321551 CCTCGGCCTCCCCAGGCCCCAGG + Intergenic
949163646 3:911484-911506 CCTCTGTGTCACCAGCACCTAGG - Intergenic
950609126 3:14113677-14113699 CCTCCTTTTCACCAGTCCCCAGG - Intronic
952885467 3:38008966-38008988 CCTTCGAGGCTCCAGGCCCCCGG + Intronic
954146548 3:48637231-48637253 CCTCCGTGGCCCTAGGCACCTGG - Exonic
954375705 3:50193185-50193207 CCTGCCTGTCCCGAGGCCCCTGG + Intronic
954661558 3:52229421-52229443 CCTCCCTGTCTCCAGGCCCAGGG + Intronic
958931300 3:100210757-100210779 CCTCATTGTCACCAGGTCCTTGG - Intergenic
967044480 3:185724086-185724108 CCTAAGTGGCACCAGGACCCAGG + Intronic
968521102 4:1035198-1035220 CCTCCCTGACCCCAGGTCCCTGG - Intergenic
968594455 4:1475070-1475092 CCCCCCAGTCACCTGGCCCCCGG + Intergenic
968611634 4:1559862-1559884 CTTCCATGTGACCGGGCCCCAGG - Intergenic
968845816 4:3041070-3041092 CCTCCCTTTCCCCAGGGCCCGGG + Intergenic
969449719 4:7266106-7266128 GCTCTGTGGCACCAGGGCCCAGG - Intronic
976178185 4:82374587-82374609 CCTCAATGTCACCCGGTCCCGGG - Intergenic
977889517 4:102292030-102292052 CCTCCCAGTCCCCAGGCCTCTGG - Intronic
980948857 4:139351242-139351264 CCTTCTTGGCACCAGTCCCCTGG - Exonic
980969762 4:139557030-139557052 CCTTCGGGTCGCCAGGCCCTCGG + Intronic
999028075 5:148258866-148258888 CCTTGCTGTCTCCAGGCCCCTGG - Intergenic
999271116 5:150296884-150296906 CCACCGTGGCCCCAGGCTCCAGG + Exonic
1000002570 5:157152922-157152944 CCTCCCTCTCACCAAACCCCTGG + Intronic
1001155476 5:169269182-169269204 CCTTCATGTCTCCAGGACCCAGG + Intronic
1001823034 5:174724734-174724756 CCTCGGCGCCCCCAGGCCCCGGG - Exonic
1001847941 5:174938069-174938091 CCTCTGTATCCCCAGGCCACAGG + Intergenic
1002100125 5:176853479-176853501 CGTCCTTGTGACCAGGCCCCTGG + Intronic
1002575660 5:180172407-180172429 CCTGCATGTGACCAGGGCCCAGG + Intronic
1002689248 5:181038773-181038795 CCTCTGTCTCCCCAGGCCCGGGG + Intergenic
1003247570 6:4397377-4397399 CCTCTGTGCCGACAGGCCCCTGG + Intergenic
1003394565 6:5741976-5741998 CCTCTGTGTCAACAGGCTCCTGG + Intronic
1003409716 6:5851535-5851557 CCTGCGGGTGACCAGGCCTCCGG - Intergenic
1004342770 6:14822110-14822132 CCTCCGTGTGACCTGTCTCCAGG - Intergenic
1006029836 6:31170642-31170664 CCCTCATTTCACCAGGCCCCCGG - Exonic
1011477714 6:87764120-87764142 CCACCCTGGCACCAGGCCTCTGG - Intergenic
1017899125 6:158705008-158705030 CCTCACTGTCACCCTGCCCCGGG - Intronic
1017899141 6:158705059-158705081 CCTCACTGTCACCCTGCCCCGGG - Intronic
1017899232 6:158705369-158705391 CCTCACTGTCACCCTGCCCCGGG - Intronic
1017899246 6:158705420-158705442 CCTCAGTGTTACCCTGCCCCGGG - Intronic
1017899274 6:158705519-158705541 CCTCAGTGTTACCCTGCCCCGGG - Intronic
1018970575 6:168525981-168526003 CCTCCGTCCCACCAGGCAGCTGG + Intronic
1019349969 7:550044-550066 TCACAGGGTCACCAGGCCCCAGG + Exonic
1019444776 7:1065697-1065719 CCGCTGTGTCACCAGCACCCCGG - Intronic
1022904759 7:34845043-34845065 CCTTTCTGTCACCAGGTCCCAGG - Intronic
1023742373 7:43292387-43292409 CCTCTGTATCACAAGGCCCCTGG + Intronic
1025255678 7:57382495-57382517 TCTCCGTGGCCACAGGCCCCTGG + Intergenic
1027007450 7:74707345-74707367 CCTCTGTCTGACCAGGCCCTCGG + Intronic
1027174068 7:75892275-75892297 CCTCTGTGTCCCCAGCCCCTGGG - Intergenic
1027237244 7:76305303-76305325 CCACCCTCTCACCAGGCCCAGGG + Intergenic
1029114528 7:98230539-98230561 CCTCTCTGCCCCCAGGCCCCGGG + Intronic
1029423931 7:100485255-100485277 GCTCAGTGCCACCAGGCCCGGGG - Exonic
1029524530 7:101086941-101086963 CCTCAGTGTCCCCAGTCCACAGG - Intronic
1032410675 7:131691631-131691653 CCTGCCTGTCACCAGGCAACAGG + Intergenic
1035313432 7:157983878-157983900 CATCCGTGTGTCCAGGCACCAGG - Intronic
1036206272 8:6807607-6807629 TCTCCTTGTCACCAGCTCCCAGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1036902822 8:12684296-12684318 CAGCCGTGTCACCACCCCCCAGG - Intergenic
1037436388 8:18868002-18868024 CCTCCGTATATCCAGGCCCAAGG + Exonic
1039542585 8:38383326-38383348 AATCCTTATCACCAGGCCCCAGG - Intergenic
1039788763 8:40857086-40857108 CCTCCAGGTAACCAGGCTCCTGG - Intronic
1047229127 8:122980933-122980955 CCTCCCTGTTCCCAGGCCCTAGG - Intergenic
1049295474 8:141832008-141832030 ACTCCGTGTCACCAGGCACCAGG - Intergenic
1049598211 8:143494362-143494384 CCTCCCTCTGAGCAGGCCCCAGG + Intronic
1049651960 8:143773886-143773908 TCTCCGGGCCACCATGCCCCAGG - Intergenic
1049690678 8:143957628-143957650 CCTCCTCTTCACCAGTCCCCAGG + Intronic
1049749143 8:144275285-144275307 CCTCAGTGTGGCCTGGCCCCAGG - Intronic
1054809812 9:69425978-69426000 CCTCCGTGGCACCCGGTCTCTGG + Intergenic
1056833364 9:89934307-89934329 CCTCCATGTAACTTGGCCCCAGG + Intergenic
1060474091 9:123974212-123974234 CCTGAGTGTCACCTGGCCCTTGG - Intergenic
1060827322 9:126694615-126694637 CCTCCCTCTCACCAGGGCGCAGG - Intronic
1060917669 9:127400717-127400739 CCTCGGGGTCCCCAGGACCCCGG - Intronic
1061149738 9:128821884-128821906 CCTCCCTTCCACCAGGCCCTAGG - Exonic
1061568610 9:131461396-131461418 ACTCCCTGGCACCAGGCTCCTGG + Intronic
1062680510 9:137776772-137776794 CGACCGTGACACCAGTCCCCGGG + Exonic
1185470623 X:380454-380476 CCTCGGCGTCACCAGGCCGCAGG + Intronic
1187700847 X:21963228-21963250 CCTCCCTGTCACCCAGCCCTTGG - Intronic
1189615394 X:42778198-42778220 CCTTTGTGACACCAGGGCCCTGG - Intergenic
1192329130 X:70160060-70160082 CCTGCATGGCACCAGGTCCCTGG - Intronic
1193058015 X:77175340-77175362 CCTCTGTGTCTCCAGGGCCTGGG - Intergenic
1195613582 X:106895288-106895310 CCTCAGTGTTTCCTGGCCCCTGG + Intronic
1195705376 X:107734465-107734487 CCACCCTGTCACCAGTTCCCTGG - Intronic
1199926108 X:152465775-152465797 CCTCCATGGCCCCAGGCTCCAGG + Intergenic