ID: 1183464415

View in Genome Browser
Species Human (GRCh38)
Location 22:37972562-37972584
Sequence CCCAGCACCCAGGTTGCTGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183464415_1183464423 6 Left 1183464415 22:37972562-37972584 CCGACAGCAACCTGGGTGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 208
Right 1183464423 22:37972591-37972613 GTCTCCTGGAGCCAAGGGTTAGG 0: 1
1: 0
2: 6
3: 28
4: 248
1183464415_1183464418 -8 Left 1183464415 22:37972562-37972584 CCGACAGCAACCTGGGTGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 208
Right 1183464418 22:37972577-37972599 GTGCTGGGCCCTGTGTCTCCTGG 0: 1
1: 1
2: 4
3: 46
4: 393
1183464415_1183464428 30 Left 1183464415 22:37972562-37972584 CCGACAGCAACCTGGGTGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 208
Right 1183464428 22:37972615-37972637 CCTGAGCAGCTGTCACTCTCTGG 0: 1
1: 0
2: 2
3: 17
4: 245
1183464415_1183464420 0 Left 1183464415 22:37972562-37972584 CCGACAGCAACCTGGGTGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 208
Right 1183464420 22:37972585-37972607 CCCTGTGTCTCCTGGAGCCAAGG 0: 1
1: 0
2: 4
3: 45
4: 395
1183464415_1183464422 1 Left 1183464415 22:37972562-37972584 CCGACAGCAACCTGGGTGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 208
Right 1183464422 22:37972586-37972608 CCTGTGTCTCCTGGAGCCAAGGG 0: 1
1: 0
2: 3
3: 40
4: 413
1183464415_1183464424 7 Left 1183464415 22:37972562-37972584 CCGACAGCAACCTGGGTGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 208
Right 1183464424 22:37972592-37972614 TCTCCTGGAGCCAAGGGTTAGGG 0: 1
1: 0
2: 0
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183464415 Original CRISPR CCCAGCACCCAGGTTGCTGT CGG (reversed) Exonic
900484229 1:2913946-2913968 TCCAGCACCCATGTTCCTGAGGG - Intergenic
901768329 1:11517836-11517858 CCCAGCTCCCAGGGTTCTTTGGG - Intronic
902682374 1:18052414-18052436 TTCTGCAGCCAGGTTGCTGTAGG - Intergenic
903335261 1:22620294-22620316 CCCAGAACCCAGGTGTGTGTGGG - Intergenic
904493694 1:30875318-30875340 CACAGGGCCCAGGTTGCTGGAGG - Intronic
904925498 1:34044422-34044444 CCCAGCCCACAGGATGCTTTAGG - Intronic
905175173 1:36130862-36130884 CCCAGCAGCCTGGTTGGTGTGGG + Intergenic
907357703 1:53889873-53889895 CGCAGCACGCAGGTTTCTCTGGG - Intergenic
907458762 1:54592903-54592925 CTCAGCAGCCAGGTTTTTGTGGG + Intronic
909404673 1:75274474-75274496 CCAAGCAACCTGGCTGCTGTGGG - Intronic
910842120 1:91570950-91570972 CCCAGGGCCCAGGTTACTGCTGG - Intergenic
912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG + Intronic
912799086 1:112710217-112710239 CCCGGAACCCAGCTTGTTGTTGG + Exonic
913530778 1:119732824-119732846 GCCAGCCCCCAGGTTGTTCTTGG + Intronic
914245891 1:145885715-145885737 TCCAGCACACAGGTGGCGGTAGG - Exonic
915353446 1:155240842-155240864 AGCTGCACCCAGGTTTCTGTGGG - Intronic
916142372 1:161711034-161711056 TAGAGCACCCTGGTTGCTGTGGG - Intronic
918483092 1:185000755-185000777 CACAGCACCCAGGCTACTGCTGG + Intergenic
919745351 1:201005266-201005288 CCCAGGAGCCAGCTTGCTGCAGG - Intronic
920210595 1:204325582-204325604 CTCAGCACACACGTTACTGTGGG + Intronic
921568418 1:216749098-216749120 CCCAGCAAACAGGCTGCTGCTGG - Intronic
922504288 1:226117707-226117729 CACAGAAGCCAGGTTGCTGGGGG - Intergenic
923944220 1:238864669-238864691 AGCAGCATCCAGGTTGCTGGGGG + Intergenic
1063280933 10:4628531-4628553 GCCAGCTCCCAGGCTGTTGTTGG - Intergenic
1067188467 10:44050062-44050084 CCCAGCACAGAGTCTGCTGTGGG - Intergenic
1067218955 10:44327795-44327817 CCCAGGACCCAGGCTTCTTTGGG - Intergenic
1067249426 10:44574654-44574676 CTCAGCTCCCAGGTTTCAGTTGG - Intergenic
1069490832 10:68859020-68859042 CCCAGGCCCCAGGTCTCTGTGGG - Intronic
1070822301 10:79366370-79366392 CACTGCACCCAGCTTGCTTTTGG + Intergenic
1072236564 10:93458908-93458930 CCCAGCACACAGCTGCCTGTGGG + Intronic
1072546353 10:96442425-96442447 CCCAACCCTCAGGATGCTGTCGG - Intronic
1075058243 10:119236081-119236103 GCCAGGGCCCAGGTTGCAGTGGG + Intronic
1075087190 10:119421610-119421632 GCCACTACCCAGGCTGCTGTTGG + Intronic
1076017607 10:127040631-127040653 CCCAACACCCAGGGGGCTTTTGG - Intronic
1076368100 10:129935264-129935286 CCCAGCACCCAGAGTGGAGTTGG + Intronic
1077143904 11:1036413-1036435 CCCAGCACCGCGGCTGCTGGGGG + Intronic
1077181875 11:1220492-1220514 CCCAGCACCCAGGTGGGCATCGG + Intergenic
1077411848 11:2407363-2407385 CCCTGCACCCTGATTGCTGTTGG + Intronic
1079097290 11:17519082-17519104 CTCAGCACCCAGTTTGCAATAGG - Intronic
1079956509 11:26873056-26873078 CACTGCACCCAGCTTGCTGTGGG - Intergenic
1080148563 11:29020501-29020523 CCCAGCAGCCAGGGGGCTGATGG - Intergenic
1081280323 11:41201866-41201888 GCAAGCACCCAGGATGCTTTTGG + Intronic
1081380375 11:42407471-42407493 GCCAGCATCAAGGTGGCTGTGGG + Intergenic
1081675510 11:44966798-44966820 CCCAGGACCGGGGCTGCTGTGGG + Intergenic
1083945743 11:65921614-65921636 CCCAGCTCCCAGTTTCATGTGGG - Intergenic
1084418619 11:69049175-69049197 CCCAGCACCCCGCTTTCTGCCGG + Intronic
1085303518 11:75472487-75472509 CCCAGCTCCCAGGGTGATCTGGG + Intronic
1086148356 11:83580731-83580753 ACCTGCACCCTGGTTTCTGTGGG + Intronic
1086510124 11:87547686-87547708 CCCAACAACCAGGTTTCTGCAGG - Intergenic
1089630142 11:119779317-119779339 CCCTGCACTCAGCTTGCTGTTGG + Intergenic
1090867952 11:130718812-130718834 TCCAGCTCCCAGCTTGCTCTTGG + Intergenic
1091753783 12:3038828-3038850 CCCAGAACACAGGGTGCTGCAGG - Intronic
1092915974 12:13189323-13189345 CACTGCACCCAGGGTGCTGAAGG + Intergenic
1101391309 12:104303140-104303162 CCCAGCACCCAGTTTCCTGCAGG + Intronic
1102040656 12:109798671-109798693 CACGGCCTCCAGGTTGCTGTCGG + Exonic
1103216036 12:119202189-119202211 CCCAGCTCTCAGGTTGCTGAAGG + Intronic
1103517324 12:121515768-121515790 CCCAGCACCCAGTGTGCAGGCGG - Intronic
1103557375 12:121774827-121774849 CCCCGGCCCCAGGATGCTGTGGG - Intronic
1104902149 12:132195241-132195263 CCCAGCAGGCAGGGTGCTGGGGG + Intergenic
1105348868 13:19598610-19598632 CACTGCACCCAGCGTGCTGTTGG - Intergenic
1105737937 13:23290923-23290945 CCCAGCAATCAGGGTGCTCTTGG - Intronic
1106698808 13:32207039-32207061 CCAAGCACCCAGGTAGCTCCTGG - Intronic
1107799551 13:44092121-44092143 CCCAGCACCCAGGTTGATCCAGG + Intergenic
1113780709 13:112975529-112975551 CCCAGCAGGCAGGAAGCTGTGGG + Intronic
1116044830 14:39731995-39732017 CCGAGTAGCCAGGATGCTGTAGG + Intergenic
1116083462 14:40204836-40204858 CCCAGCACCCAGTCTGATTTTGG - Intergenic
1117097331 14:52312274-52312296 CCCAGGACCAAGGTGGCTTTGGG + Intergenic
1119428845 14:74552625-74552647 CCCATCTCCCAGGTTATTGTGGG - Intronic
1119740998 14:77013792-77013814 GCCTGCACCCAGGGTGCTGGAGG + Intergenic
1120762852 14:88301786-88301808 GCCAGCACTCAGGGTGCTGCAGG + Intronic
1122323168 14:100867567-100867589 ATCGGCACCCAGGGTGCTGTAGG - Intergenic
1122347970 14:101072149-101072171 CCCAGCAGCCAGGTGTCTATAGG + Intergenic
1122924375 14:104892874-104892896 CCCAGCTCCCAGGCAGCTGCTGG - Intronic
1124322583 15:28726148-28726170 CCCAGCACCCAGGGAGGTGGAGG - Intronic
1125720140 15:41841433-41841455 CGCAGCACCCTGGCTGCTGCTGG - Intronic
1127625532 15:60776459-60776481 CCCAGCACCCAGCTCTCTGTAGG - Intronic
1128911086 15:71515690-71515712 CCCAGCAGCTAGTTTGCTGCTGG + Intronic
1130792439 15:87169893-87169915 CCCAGAAACAAGGTTGTTGTGGG + Intergenic
1131749352 15:95489941-95489963 CCCACTACACAGGTTGCTATAGG - Intergenic
1131891600 15:96977982-96978004 CCCAGCCCCCAGTTTCCTTTCGG + Intergenic
1133103377 16:3492507-3492529 CCCAGCTCCCAGGTCCCTCTGGG - Intergenic
1133318274 16:4897521-4897543 CCCAGCACCCATGCTTCTGATGG - Intronic
1136402303 16:30025291-30025313 CGCAGCGCCCAGGTTGACGTGGG + Exonic
1138479039 16:57289595-57289617 CCCAGCACCCCACTTGCAGTAGG + Intergenic
1139516813 16:67457199-67457221 TCCAGCACACAGGTTGCTCCTGG - Intronic
1141174811 16:81711903-81711925 CTCAGCATCCTGGCTGCTGTTGG + Intergenic
1141576606 16:84967888-84967910 CCCTGCCTCGAGGTTGCTGTGGG + Intergenic
1141699542 16:85636125-85636147 CCCAGTGCCCAGGTTGCAGCTGG - Intronic
1141887795 16:86904635-86904657 CCCAGCACACAGGTATCTCTGGG + Intergenic
1141999869 16:87658134-87658156 CCCTGCACCCAGGTTGGTGTTGG - Intronic
1142884944 17:2906581-2906603 CCCAGCACCCAGCTCAGTGTTGG + Intronic
1143462399 17:7112337-7112359 CCCACCACCCGGGCTGCTGGAGG + Intronic
1143887006 17:10072323-10072345 CCCAGCACCCAGGCCCCTGCTGG + Intronic
1144205013 17:12973912-12973934 CCCAGCACCCTGGCTGCTCCCGG - Intronic
1145264926 17:21375315-21375337 GCCCGCACCCAGATTGCTGGCGG - Intergenic
1147235352 17:39053117-39053139 CCCAGTCCCCTGGTTCCTGTTGG + Intergenic
1147337568 17:39736859-39736881 GCCACCACCCAGCTTGATGTGGG - Intergenic
1147386161 17:40083628-40083650 CTCAGCCCCCAGGCTGCTGAGGG - Intronic
1147459718 17:40560470-40560492 CATGGCACCCAGGTTGCAGTTGG + Intronic
1147580453 17:41624690-41624712 GCCAGCTCCCAGGTGGCTGGGGG + Intronic
1148332564 17:46821052-46821074 GCCAGCATCCTGGGTGCTGTGGG + Intronic
1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG + Intergenic
1149376302 17:56047540-56047562 CCCAGCTCCCAAGTTGCTATGGG + Intergenic
1152476466 17:80521582-80521604 CCCAGCTCCCAGCTGGCTGTTGG - Intergenic
1155540779 18:26865726-26865748 CCCAGCACACAGGGAGCTGCGGG - Exonic
1155563677 18:27109225-27109247 GCCAGCTCCCAGGTGGCTGGAGG - Intronic
1157149192 18:45198110-45198132 CAAAGCACCCAGGTAGCTATAGG - Intergenic
1158439326 18:57460171-57460193 CCCAGCACACAGGCTGAGGTGGG - Intronic
1159419765 18:68202494-68202516 CCCTGCACACATTTTGCTGTGGG - Intergenic
1159490750 18:69131171-69131193 CGCAGCACCTAAATTGCTGTGGG + Intergenic
1159796530 18:72851083-72851105 CCTAACACCCAGGTTTCTTTGGG - Intronic
1160257099 18:77256664-77256686 CCCAGCACTCTGGTGGCTTTAGG - Intronic
1160693427 19:470828-470850 CCCGGCACCCAGGGAGCTGTTGG - Intronic
1161053798 19:2179872-2179894 CCCTGCACCCAGCCTGTTGTGGG + Intronic
1161140908 19:2647247-2647269 CCCAGCACCCACGTTCCTATGGG - Intronic
1162833047 19:13298884-13298906 CCCAGAACCCGGGTTGCTCCAGG + Exonic
1163550962 19:17966419-17966441 CCCAGCACCCAGGCTGAACTTGG - Intronic
1164534692 19:29076389-29076411 CTCAGCAGCCAGCTTCCTGTAGG + Intergenic
1165102578 19:33447570-33447592 CCCAGGAGCCAGGCTGCTGGTGG - Intronic
1165215525 19:34269312-34269334 CCAGGCACCCAGGATGCAGTGGG - Intronic
1166379884 19:42350373-42350395 GCCTGCACCCAGGTGCCTGTGGG + Exonic
1166759564 19:45216103-45216125 CCCAGCATCCAGGTGGAGGTGGG - Exonic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1167455491 19:49595324-49595346 CCCACCACCCAGGGGGCTGCAGG - Exonic
925381396 2:3429024-3429046 CCCAGCACCCAGGCTGCAAGCGG + Intronic
926121580 2:10243872-10243894 ACCAGCACACAGGCTGCTGGCGG - Intergenic
927141526 2:20134455-20134477 CCCAGCATCCTGCTTGCTTTGGG - Intergenic
929999582 2:46851726-46851748 CCCAGCACCCAGGCCGAGGTGGG - Intronic
932357450 2:71078160-71078182 CCCAGCACACAGGGTGCACTGGG - Intronic
932481317 2:72041167-72041189 CCCAGCACCCAGCATGCTATTGG + Intergenic
932717533 2:74112712-74112734 CACTGCACCCAGCCTGCTGTGGG - Intergenic
933643835 2:84793130-84793152 CCCAGCATCATGGTTCCTGTGGG - Intronic
936249204 2:110854446-110854468 CCCAGCACCCTGGGTGGTGTTGG - Intronic
937314501 2:120922432-120922454 CCCAGCACCCAGCATGCAGCAGG - Intronic
941514460 2:166455595-166455617 CCCATCACCCAGGTAGCGTTTGG - Intronic
942124398 2:172809183-172809205 CACAGCCCCCAGGTTAGTGTGGG + Intronic
944758910 2:202792728-202792750 CCCAGAAGGCAGGTTGCAGTGGG + Intronic
945903473 2:215564942-215564964 CACAACACCCAGGTTAGTGTTGG + Intergenic
947652210 2:231796406-231796428 CCCAGCTCCCAGGTAGCTACAGG - Intronic
947832832 2:233153871-233153893 CCCAGCTCCCAGGATGCTGCTGG + Intronic
948424355 2:237877935-237877957 CCCAGCACCCAGGAGGCTGAGGG - Intronic
948722648 2:239911265-239911287 CCCAGCCCCTAGGCTGCTGCAGG + Intronic
948899145 2:240947369-240947391 GGCAGCACCCAGGCTGCTGAGGG - Intronic
1169632377 20:7647688-7647710 CACAGCACCCAGGTGCCTGTAGG + Intergenic
1170440895 20:16377731-16377753 TGCATCACCCAGGTGGCTGTTGG + Intronic
1170533266 20:17315507-17315529 CCCAGCTCCCGGGTCTCTGTCGG + Intronic
1172186890 20:33036544-33036566 CCCAGCTCCCAGGTGGCCCTAGG - Intronic
1173304009 20:41830814-41830836 CCCACCACCATGTTTGCTGTGGG + Intergenic
1173807327 20:45934579-45934601 CCTCGCACCCAGCTTGCTTTCGG - Intergenic
1174264042 20:49318668-49318690 CCCAGCACCTAGGGGGCTCTGGG + Intergenic
1175306070 20:57976424-57976446 CCCAGCTCCCAGGTTGGCCTAGG + Intergenic
1175514780 20:59562122-59562144 CACAGACCCCAGGATGCTGTGGG + Intergenic
1176238261 20:64064136-64064158 CCCACAACCCAAGTTGCTGCGGG - Intronic
1179886230 21:44315353-44315375 CCCACCACCCAGGGTGCACTGGG + Intronic
1181043855 22:20205426-20205448 CCCAGCACACAGGAGGCAGTGGG - Intergenic
1181227180 22:21399514-21399536 CCCAGCACTCAGGAGGCTGAGGG + Intergenic
1181985727 22:26798881-26798903 CCCAGCACACAGGAAGCTCTGGG + Intergenic
1183440877 22:37822502-37822524 CCCAGCACCCAGCATGCAGTAGG - Intergenic
1183464415 22:37972562-37972584 CCCAGCACCCAGGTTGCTGTCGG - Exonic
1184098989 22:42331657-42331679 CAGAGCCCCCAGGCTGCTGTTGG - Intronic
1184161776 22:42701304-42701326 CCCAGGACACAGGTTGCTGTGGG + Intronic
949459941 3:4280679-4280701 CCCAGCACGCACCTTGATGTTGG - Intronic
950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG + Intronic
950702073 3:14757663-14757685 CCCTGCATCCAGGTTGGTCTGGG + Exonic
953391025 3:42533843-42533865 CTCTGCCCCCAGCTTGCTGTGGG + Intronic
953447827 3:42982773-42982795 CCCAGGGCCCAGCGTGCTGTGGG + Intronic
953688124 3:45094184-45094206 CCCAGCAAGGAGGTGGCTGTTGG + Intronic
953885413 3:46712186-46712208 CTCCGTGCCCAGGTTGCTGTGGG - Exonic
954012303 3:47652256-47652278 CACAGCACCCAGGCTTCTGTGGG + Intronic
954380121 3:50214854-50214876 CCCAGCATCCAGGCTGCAGTGGG + Intronic
954538843 3:51380779-51380801 CCCAGGTCCCAGGCTGCCGTCGG - Intronic
954584025 3:51718903-51718925 CCCGGCCCCCAGGATGGTGTGGG + Intergenic
954793196 3:53147823-53147845 CCCAGAACCCAGGGTACTGTGGG + Intergenic
957446969 3:80325874-80325896 CCCAGGACCAAGTTTGCTGCTGG + Intergenic
958149406 3:89670869-89670891 CCCAGGAAGAAGGTTGCTGTAGG + Intergenic
958183721 3:90091643-90091665 CACAGCACCCAGCTTTCTGTGGG + Intergenic
958709810 3:97704295-97704317 CCCATCACCCATGTTGATGAGGG - Intronic
961105650 3:124238740-124238762 CCCAGGACCAAGGATCCTGTTGG + Intronic
961525195 3:127492331-127492353 CCCACCTCTCAGGTTCCTGTGGG - Intergenic
962704838 3:138032985-138033007 CCCTGCACCAATGCTGCTGTGGG - Exonic
965507203 3:169529791-169529813 TCCAGCACCCAAGTTCCTCTGGG + Intronic
967224167 3:187275111-187275133 CCCAGCCTCCAAGTTGCTGAAGG - Intronic
968702780 4:2064680-2064702 CCCAGCCCCCAGCTGGCTGTGGG + Exonic
968927731 4:3558734-3558756 CCAAGCACCCTGGTTGCTGTAGG - Intergenic
969251980 4:5974000-5974022 CCCAGAAGCCAGGCTGCTTTCGG + Intronic
969682742 4:8652320-8652342 CCCAGCTCCCAGGAAGATGTGGG + Intergenic
972680905 4:41306030-41306052 TCCAGCACCGAGGTAGCTTTGGG - Intergenic
974142626 4:57907332-57907354 CCCAGGACCCACGTTCCTGATGG - Intergenic
975466548 4:74715688-74715710 CCAAGCATCAATGTTGCTGTAGG - Intergenic
976148750 4:82071272-82071294 CCAAGCACCTTGGTTGGTGTCGG + Intergenic
983139971 4:164138082-164138104 CCCAGCAGCCAGTGAGCTGTTGG + Intronic
985061061 4:186079917-186079939 GACAGCGCCCAGGTTGCAGTGGG + Intronic
986469607 5:8060861-8060883 CCCAGCCCCCAGGTGGCTGGTGG + Intergenic
986694415 5:10339348-10339370 CCCAGCCCCCATTTTGCTGTTGG + Intergenic
989377560 5:40780644-40780666 CCCAGGACCCAGGGGGCTGCTGG + Intronic
989377731 5:40782412-40782434 CCCATAGCCCAGGTTGCTTTTGG - Intronic
989814783 5:45722671-45722693 GCCAGCACCCAGTATCCTGTGGG - Intergenic
998621621 5:143800840-143800862 TGCAGGACCCAGGTTGCTGGTGG - Intergenic
999326721 5:150648675-150648697 CCCAGCACCCTGTGTGCTGATGG + Exonic
1001197777 5:169689143-169689165 CCCAGCAGCCAGTATGGTGTTGG + Intronic
1004641658 6:17521785-17521807 ACAAGTGCCCAGGTTGCTGTTGG - Intronic
1005881530 6:30066028-30066050 CCCATTCTCCAGGTTGCTGTGGG - Intergenic
1007163295 6:39810462-39810484 CCCAGACCCCTGGTTGCTGTGGG + Intronic
1011472009 6:87717455-87717477 CCCAGCTCCCAGGTGGCTCCTGG - Intergenic
1011521182 6:88208734-88208756 CCCATCATCCAGGTAGCTGGTGG + Intergenic
1012449792 6:99343170-99343192 CCCAGCACCCAGTTTGTCGAAGG + Intronic
1016096339 6:140042247-140042269 CCCAGGAGCAAGGTTGCTCTAGG + Intergenic
1019744867 7:2694014-2694036 CCCAGCACCCAGGAAGCCCTTGG + Intronic
1021553325 7:21895029-21895051 CCCAGCACCGAGGCTGCTCAGGG - Intronic
1024050973 7:45623230-45623252 CCCAGCACGCAGTCTGCTGAGGG - Intronic
1027363650 7:77434482-77434504 CCCAGCACCCTGTTTCCTGTTGG - Intergenic
1029016192 7:97317202-97317224 TCCAGCATCCAGTTTGCTCTGGG + Intergenic
1030510911 7:110481089-110481111 CCCTGCATCCAAGCTGCTGTAGG - Intergenic
1031253064 7:119413295-119413317 TCCTGCACCCAGGTTGCAGGTGG + Intergenic
1032162865 7:129524013-129524035 CCCAGCACCCTGGATGGTTTGGG + Intergenic
1032872427 7:136000707-136000729 CTCAGCACCCAGCTGGCTGTTGG - Intergenic
1033278486 7:139989827-139989849 CTCAGCACCCTGATTGCTATAGG - Intronic
1035046733 7:155972776-155972798 CCCTGCCCACAGCTTGCTGTTGG + Intergenic
1035640287 8:1179496-1179518 CCCAGCAGCCAGGTGCCTGTGGG - Intergenic
1035824179 8:2626999-2627021 CACAGAACTCAGGCTGCTGTGGG + Intergenic
1037271633 8:17136674-17136696 ACCTGCACCCAGGCCGCTGTTGG - Intergenic
1042224370 8:66504074-66504096 CCCAGCAGCCAGATGGATGTAGG - Intronic
1042606437 8:70551256-70551278 CCCATCACCCAGATTGTTGGAGG + Intergenic
1044071332 8:87763749-87763771 CACTGCACTCAGGTTGCAGTGGG - Intergenic
1045443070 8:102234372-102234394 CCCAGCTCAAAGGTTGATGTTGG - Intronic
1045530149 8:102977098-102977120 CCCAGCATCGGGGTTGCTGCTGG - Intronic
1047124202 8:121942335-121942357 CCCAGAACCCATCTTCCTGTGGG - Intergenic
1048292649 8:133192294-133192316 CCCAGGTCTCAGTTTGCTGTCGG - Intronic
1049206576 8:141366418-141366440 GCCAGCAGCCAGGGTGCTGGCGG - Intronic
1049616327 8:143577264-143577286 CTCACCGCCCAGGTAGCTGTAGG + Exonic
1051333939 9:16049594-16049616 CTCAGGACCCAGGGTGCTGCTGG - Intronic
1053802586 9:41773813-41773835 CAAAGCACCCTGGTTGCTGTAGG - Intergenic
1054142652 9:61541257-61541279 CAAAGCACCCTGGTTGCTGTAGG + Intergenic
1054190894 9:61985159-61985181 CAAAGAACCCTGGTTGCTGTAGG - Intergenic
1054462403 9:65472407-65472429 CAAAGCACCCTGGTTGCTGTAGG + Intergenic
1054647477 9:67602558-67602580 CAAAGCACCCTGGTTGCTGTAGG + Intergenic
1055716847 9:79127329-79127351 CCCTGCACCCAGGCAGGTGTGGG - Intergenic
1055923603 9:81488266-81488288 CCCTCCACCTGGGTTGCTGTTGG - Intergenic
1056125986 9:83537347-83537369 CCCAGGACCCAGGTTCCTGCAGG + Intronic
1056510609 9:87301471-87301493 CCCAGGACTCAGGTTCCTTTTGG - Intergenic
1060958928 9:127665192-127665214 CCCAGCACCCATGATGGTGCTGG - Intronic
1062048194 9:134434020-134434042 CCCAGGACCCAGGCTTGTGTGGG - Intronic
1062637060 9:137497119-137497141 GCCAGAACCCAGGATGCTCTGGG + Intronic
1186487029 X:9941378-9941400 CACACCACCCAGGGTGCTGAAGG - Intronic
1190087738 X:47410379-47410401 CACAGATGCCAGGTTGCTGTAGG - Exonic
1190189629 X:48266580-48266602 CTCACCACCCAGGATGCTGTGGG + Intronic
1191863286 X:65683435-65683457 ACCACCACCCAGGCTGCTTTAGG + Intronic
1192463289 X:71336329-71336351 CCCTGCTCCCAGGATGCTCTGGG - Intergenic
1196146057 X:112318139-112318161 CCCAACCCCCAGGTTGCTTTAGG + Intergenic
1198458253 X:136838454-136838476 CCCAGAGCCCAGGTGGCTGCTGG + Intergenic