ID: 1183466743

View in Genome Browser
Species Human (GRCh38)
Location 22:37983910-37983932
Sequence CCCCGAGGGCGGCCCGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183466735_1183466743 19 Left 1183466735 22:37983868-37983890 CCTGGATGGAAGGAGGGCGCGAT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG 0: 1
1: 0
2: 0
3: 8
4: 100
1183466734_1183466743 22 Left 1183466734 22:37983865-37983887 CCACCTGGATGGAAGGAGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 136
Right 1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG 0: 1
1: 0
2: 0
3: 8
4: 100
1183466733_1183466743 23 Left 1183466733 22:37983864-37983886 CCCACCTGGATGGAAGGAGGGCG 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG 0: 1
1: 0
2: 0
3: 8
4: 100
1183466729_1183466743 29 Left 1183466729 22:37983858-37983880 CCAACGCCCACCTGGATGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183466743 Original CRISPR CCCCGAGGGCGGCCCGAGAC AGG Intronic
900195867 1:1375174-1375196 GCCCGAGGGCGGCCGCAGAACGG - Intronic
900435698 1:2629565-2629587 CCCCGAGCCCGGCCCGAGGCTGG + Intronic
904599197 1:31664532-31664554 CCCAGAGGTTGGGCCGAGACAGG + Intronic
919505492 1:198393072-198393094 ACCCGAGGGAGGCCCAAAACTGG + Intergenic
923684289 1:236143083-236143105 CCCCGCGGGGCGCCCGAGGCAGG + Intronic
1063459015 10:6203654-6203676 CGGCGACGGCCGCCCGAGACGGG - Intronic
1063929836 10:11018012-11018034 GGCCGCGGGCGGCGCGAGACGGG - Exonic
1069594843 10:69663898-69663920 CCCCCAGGAGAGCCCGAGACCGG - Intergenic
1069756225 10:70775797-70775819 CCCAGAGGGCAGCCTGAGGCGGG + Intronic
1069769568 10:70888610-70888632 ACCGGAGGGCGGCCCGAGCGCGG - Exonic
1069900440 10:71703791-71703813 CCCCGAGGAAGCCCCCAGACCGG + Intronic
1070140321 10:73733387-73733409 CCAGGCGGGCGCCCCGAGACGGG + Intergenic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1073288760 10:102403109-102403131 CCTCGTGGGTGGCCCGAGGCCGG + Exonic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1077008133 11:368888-368910 CACCGAGCGCGGCCTGAGGCAGG - Intergenic
1077081742 11:727415-727437 CCCTGAGGGGGGCCCGGGAGGGG + Exonic
1079128423 11:17734562-17734584 CCCCGAGGGCGGACCGTGGGCGG + Intergenic
1080836351 11:35944232-35944254 CCCGGAGAGCGGCCCGCGCCCGG - Intronic
1083158864 11:60842365-60842387 CCCCAAGGGCAGCCAGAGCCAGG + Exonic
1083258316 11:61509811-61509833 CCCCGGGGGCGCCCAGAGCCCGG - Exonic
1090406642 11:126479719-126479741 CCCCGGGGCCGGCCAGAGAAAGG + Intronic
1095476277 12:42589910-42589932 CCCCGGGCGCGGCCCGAGCCGGG - Intronic
1100468814 12:94873099-94873121 CCCCGAGGGCGCCCCAGGCCAGG + Intergenic
1104928307 12:132325108-132325130 CCCCCAGGGAGGCCTGAGCCGGG - Intronic
1105503154 13:20989379-20989401 CCCCGAGGGCAGCGCTAGAGTGG - Intronic
1113900842 13:113797098-113797120 CCCCGACTGCGGTCAGAGACTGG - Intronic
1119046301 14:71321033-71321055 CGGCGAGGCCGGCCCGAGGCGGG - Intronic
1122317933 14:100836576-100836598 CCCCGAGAGCGGCTCGGGCCAGG + Intergenic
1122465852 14:101933085-101933107 CCCAGAGGTCGGCGTGAGACTGG + Intergenic
1127961168 15:63891978-63892000 CCCCGAGGGAGGGCAGGGACTGG - Intergenic
1129656264 15:77527413-77527435 CCCTGAGGGCTGCCCCAGGCGGG + Intergenic
1132689421 16:1175862-1175884 GCCCAAGGTCTGCCCGAGACGGG - Intronic
1132725336 16:1335951-1335973 TCCCCAGAGCGGCCCGAGAGGGG - Intronic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1133164844 16:3939108-3939130 TCCCGAGGGCGGCCAGAGGCTGG + Intergenic
1133212920 16:4273121-4273143 CCCCCCGGGCGGCGCGAGGCCGG + Intergenic
1140046190 16:71441861-71441883 CTCCGCGGGCGGCCCCAGCCTGG + Intergenic
1141819000 16:86432275-86432297 CCCCGAGGCGGGCCCGTGGCAGG + Intergenic
1142866745 17:2796059-2796081 TCCCGAGGGCTGCCTGAGACAGG - Intronic
1143030387 17:3964213-3964235 AGCCGAGGGCGGCCTGAGCCCGG - Exonic
1143444500 17:6999405-6999427 CCCCGAGGGCAGCACTAGCCTGG - Exonic
1146400731 17:32498137-32498159 CCCCGAGAGGGGACAGAGACAGG - Intronic
1148193013 17:45692905-45692927 CCCAGAGGGAGGCCTGAGCCAGG + Intergenic
1151215099 17:72571754-72571776 CCTTGAGGGTGGCCCGAGAGAGG - Intergenic
1157335273 18:46733151-46733173 CCCCGAAGGCGGCTCAACACTGG + Intronic
1158976708 18:62716475-62716497 CCCCGAGGCCGGCCCCCGGCTGG + Exonic
1160729133 19:632801-632823 CCCCCACGGCGGCCCGGGAGAGG - Intronic
1161048676 19:2150856-2150878 CTGGGAGGGTGGCCCGAGACGGG + Intronic
1161379208 19:3955842-3955864 CCCAGAGGAAGGCCAGAGACGGG + Intergenic
1161558033 19:4955409-4955431 CCCCGAGGTCCTCCCGAGAGAGG - Intronic
1161820552 19:6528382-6528404 CCCCCAGGGAGGCCCAATACAGG + Intergenic
1165061496 19:33207238-33207260 GCACCAGGGCGGCCGGAGACAGG + Exonic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
926685410 2:15694204-15694226 GCCCGGGCGCGGCCTGAGACTGG - Intronic
934503014 2:94873829-94873851 GCACGAGGGCTGCCCGGGACAGG + Intronic
935354594 2:102187204-102187226 CCCCCAGGCCGGCCCCCGACCGG + Intronic
938595319 2:132782782-132782804 CCCCGAGGGCCTCCCAACACTGG + Exonic
942646157 2:178112856-178112878 CCCCGAGGGCACCCCGACCCGGG - Intronic
947506608 2:230712860-230712882 CCCCGCTTGCGGCCCGAGCCCGG - Exonic
947743696 2:232496895-232496917 CCCCGTGGGTGGCCTGAGGCTGG - Intergenic
1172742323 20:37179011-37179033 CCTCGGGGTGGGCCCGAGACGGG - Intronic
1176097954 20:63352894-63352916 CCCAGAGGGCGGCTGGAGCCAGG - Intronic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1179920002 21:44502879-44502901 CCCCGAGGGCTCACCGAGGCCGG - Intronic
1179920038 21:44503014-44503036 CCCCGAGGGCTCACCGAGGCCGG - Intronic
1179920178 21:44503457-44503479 CCCCGAGGGCTCACCGAGGCCGG - Intronic
1179920405 21:44504220-44504242 CCCCGAGGGCTCACCGAGGCCGG - Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1184288510 22:43485928-43485950 GCCCGATGGCTGCCCGAGAGGGG - Intronic
1185327266 22:50232954-50232976 TGCCGAGAGCGTCCCGAGACTGG - Intronic
952967189 3:38628593-38628615 CCCGGAGTGAGGCCAGAGACGGG + Intronic
954337805 3:49929859-49929881 CCCCGGGGGCGGGCCGAGTCGGG - Exonic
956604949 3:71064859-71064881 CCGCGCGGGCGCCCCGAGCCCGG - Intronic
961378551 3:126482649-126482671 CCCAGAGGAGGGCCAGAGACAGG - Intronic
961453786 3:127014483-127014505 CCCCGAGACGGGCCCGAGGCAGG + Exonic
964201238 3:154121455-154121477 CCCCGTGGGTGGCCCGGGTCCGG - Intronic
979785737 4:124712941-124712963 CCCCCACGCCGCCCCGAGACAGG - Intergenic
990410261 5:55534765-55534787 AGCCGAGGGCGGGCTGAGACCGG + Exonic
995142407 5:108748850-108748872 CCTCGAGGGTGCCCGGAGACCGG + Intronic
997470658 5:134115209-134115231 CCCCGAGGGCCGCGCGCAACTGG - Intronic
1002083126 5:176749186-176749208 CCCCGAGGATGGCCTGAGTCAGG - Intergenic
1002091834 5:176810649-176810671 CCCCGGGGGCGCCCCGAGCTGGG + Exonic
1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG + Intergenic
1006375857 6:33671319-33671341 CCACCAGGGTGGCCCGAGCCGGG - Intronic
1006838903 6:37015682-37015704 CCCCGAGGGTGGGCCGAGCATGG - Intronic
1019167678 6:170109426-170109448 CCCCAGGGGCGGTCAGAGACAGG - Intergenic
1022923335 7:35037427-35037449 CCCGGACGGCGGCCAGAGAACGG + Intronic
1023940472 7:44765870-44765892 CCCAGAGGGGGGCCCCAGATGGG - Intronic
1026017469 7:66682421-66682443 AACCGAGGGCGGCCTGAAACGGG - Intronic
1032802697 7:135329355-135329377 CCCAGAGGGCGGACCCTGACAGG - Intergenic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1039502995 8:38031426-38031448 TCCTGAGGGCAGCCCGAGGCTGG - Intronic
1040294489 8:46142175-46142197 CCCCCAGGGCTGCCCCAGATGGG - Intergenic
1040307341 8:46218981-46219003 CCCCCAGGGCTGTCCCAGACTGG - Intergenic
1040308055 8:46222441-46222463 CCCCTAGGGCTGTCCCAGACAGG + Intergenic
1040333718 8:46405513-46405535 CCCCCAGGACTGTCCGAGACAGG + Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1046865871 8:119149780-119149802 CACCGTGCCCGGCCCGAGACTGG - Intergenic
1049220168 8:141425441-141425463 CCCAGAGGAGGGCCTGAGACAGG - Intronic
1057208183 9:93185343-93185365 CCCCGACGGCGGCCCCAGGGAGG + Exonic
1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG + Intronic
1060855954 9:126915098-126915120 CCCCGAGGGCCGCCGAAGCCGGG + Intronic
1062004284 9:134231548-134231570 CCCTGAGGGTGGCAAGAGACCGG - Intergenic
1062310517 9:135933340-135933362 CCCCTGGTGCGGCCCGAGACCGG - Exonic
1062340209 9:136090786-136090808 CCCCGAGGGCAGCCCGGCCCTGG - Intronic
1062493660 9:136821647-136821669 CGCGGCGGGAGGCCCGAGACGGG - Intronic
1189104249 X:38220469-38220491 CCGCGAGGGCGCCCCGCGCCTGG + Intronic