ID: 1183467102

View in Genome Browser
Species Human (GRCh38)
Location 22:37985303-37985325
Sequence CACTGGGCTCACCCTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183467098_1183467102 -10 Left 1183467098 22:37985290-37985312 CCAGCTCCTTCCACACTGGGCTC No data
Right 1183467102 22:37985303-37985325 CACTGGGCTCACCCTGTCTTGGG No data
1183467097_1183467102 -9 Left 1183467097 22:37985289-37985311 CCCAGCTCCTTCCACACTGGGCT 0: 1
1: 0
2: 4
3: 44
4: 412
Right 1183467102 22:37985303-37985325 CACTGGGCTCACCCTGTCTTGGG No data
1183467094_1183467102 1 Left 1183467094 22:37985279-37985301 CCTACTGGGACCCAGCTCCTTCC 0: 1
1: 0
2: 3
3: 30
4: 295
Right 1183467102 22:37985303-37985325 CACTGGGCTCACCCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183467102 Original CRISPR CACTGGGCTCACCCTGTCTT GGG Intronic
No off target data available for this crispr