ID: 1183467869

View in Genome Browser
Species Human (GRCh38)
Location 22:37988920-37988942
Sequence CTATGCACTGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183467857_1183467869 9 Left 1183467857 22:37988888-37988910 CCGGAGAGCTTTGGGGTGTGGCA 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183467869 Original CRISPR CTATGCACTGGGAAGGTGGA GGG Intronic
902057449 1:13613677-13613699 CTATTCACAGAGAAAGTGGATGG + Exonic
902171286 1:14613461-14613483 CTATTCAGTGGGAATATGGATGG - Intronic
902273083 1:15318689-15318711 CTATGCACTTGGAACGTGGCTGG - Intronic
902577322 1:17386550-17386572 GTCTGCACTGGGAAGTTGCAGGG + Intronic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
905479661 1:38252700-38252722 CTATGGACTGGGATGGTGCTGGG + Intergenic
906148775 1:43575672-43575694 CTCTGCTCTGGGGAGGAGGAGGG - Intronic
907580861 1:55571488-55571510 CAATGCACTGGGGAGAGGGACGG - Intergenic
912538128 1:110391198-110391220 CTATGCTCAGGGCAGGGGGATGG + Intergenic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
914754890 1:150557064-150557086 CCCTGCACTTGGAAGGAGGAGGG + Intronic
915353784 1:155243410-155243432 CTATGCAGAGGGGAAGTGGAAGG - Intronic
915457950 1:156053316-156053338 CCTTGCACCGGGAAGGGGGAAGG - Intronic
918916064 1:190639427-190639449 ATGTGCACTTGGAGGGTGGAGGG + Intergenic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
921018694 1:211216204-211216226 CAATCCACTGTGAAGTTGGAAGG - Intergenic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
923224913 1:231930299-231930321 CGATGCAGTGGGAGGGTCGATGG + Intronic
923939809 1:238809376-238809398 TTATGGACTGGGAATGGGGAGGG + Intergenic
923997884 1:239517115-239517137 CTATGGACCGGGCAGGAGGATGG - Intronic
924244486 1:242070411-242070433 CCATGGACTGGGCAGGGGGATGG + Intergenic
924603364 1:245510832-245510854 AGCTGCACTGGGAAGGTGGCTGG + Intronic
924821753 1:247498744-247498766 CCATGGACTGGGCAGGGGGACGG + Intergenic
1067394967 10:45906780-45906802 CAATGCACCGGGAAAGAGGATGG - Intergenic
1068262026 10:54595043-54595065 GTATGGTTTGGGAAGGTGGAGGG - Intronic
1070538138 10:77394501-77394523 CGAAGCAGTGGGCAGGTGGATGG + Intronic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071805699 10:89118417-89118439 CTATGCACTGGGTACTGGGAAGG + Intergenic
1072061552 10:91816496-91816518 CAATGCACTTGTAAGGTGCAAGG - Intronic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1072893375 10:99344849-99344871 CTTTGAACTGGGAAGGGGAAAGG - Intronic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1074910015 10:117899928-117899950 CTATTGAATGGGAAGATGGAAGG - Intergenic
1075253804 10:120907996-120908018 CTAGTCACTGGGAAGGTGACTGG + Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076501348 10:130938870-130938892 CTATGCTCTGGGCAGGGGGCTGG - Intergenic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1078100649 11:8328612-8328634 CAAAGCACTGAGAATGTGGATGG - Intergenic
1078331878 11:10429090-10429112 CCATGAAATGGGAAGGTGGGAGG - Intronic
1083270950 11:61572230-61572252 CTCTCTACTGGCAAGGTGGAGGG - Intronic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083798872 11:65034972-65034994 CCAAGTTCTGGGAAGGTGGAAGG - Intronic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1084182545 11:67454131-67454153 CTCTGCAGTGGGATGGTGGTGGG + Intronic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1085120431 11:73964189-73964211 CTTTGCACTGGGAGGAAGGATGG + Intronic
1085165248 11:74393823-74393845 TTAGGCACTGGCAAAGTGGATGG - Intronic
1085311576 11:75520089-75520111 CTGTTCACAGGGAAGGTGGTGGG + Intronic
1085911212 11:80829073-80829095 GAATGCATTGGGCAGGTGGAGGG - Intergenic
1086455668 11:86956299-86956321 CTGTGCACTGGGGACGAGGAAGG + Intergenic
1089535134 11:119156409-119156431 CTTGGCACTGGGCTGGTGGATGG - Exonic
1089579821 11:119474669-119474691 CCAGGGACTGGGAATGTGGAGGG + Intergenic
1090168967 11:124581485-124581507 GTATGAACTTGGAATGTGGATGG + Intergenic
1090401715 11:126453389-126453411 CCAGGCACTGGGATGGAGGAGGG + Intronic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1091577362 12:1750450-1750472 CTAGGTACTTGGCAGGTGGAGGG + Intronic
1092600103 12:10051460-10051482 ATATGCACTGGGAAGCTGTCAGG - Intronic
1093769771 12:23004740-23004762 CTAGGTACTTGGGAGGTGGAGGG + Intergenic
1094787174 12:33862094-33862116 CTATTCACAGGGAATGTGAAAGG - Intergenic
1095867008 12:46983375-46983397 CTATGCACAGGAAGGCTGGAGGG - Intergenic
1097757612 12:63424722-63424744 CTAAGCACTGGGGATGTGGCGGG + Intergenic
1098359801 12:69643240-69643262 GTCTGCAGTGGGAAGGTGGCTGG - Intergenic
1100107485 12:91193664-91193686 CTATGCAGAGGGAAGTGGGATGG - Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101328318 12:103736294-103736316 CCAGGCAGTGGGAAGGAGGAAGG + Intronic
1102351237 12:112193831-112193853 CTCTGCACCAGGATGGTGGAGGG + Intronic
1102863158 12:116353903-116353925 TTATGCATTGGGCAAGTGGAGGG - Intergenic
1103137407 12:118519486-118519508 CCAGGCACTGGGTAGGGGGATGG - Intergenic
1104381779 12:128313657-128313679 CTAGCCCCTGGGATGGTGGACGG + Intronic
1104597931 12:130132653-130132675 CCATGTTCTGGGAAGGAGGAAGG - Intergenic
1104943769 12:132406631-132406653 GTCTGCACTGGGAACGTCGACGG - Intergenic
1104963891 12:132500573-132500595 CTATGGACTGGGTGGGTGGAGGG - Intronic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1107893650 13:44936955-44936977 CCATGCACAGGGCAGGGGGATGG - Intergenic
1107904110 13:45046545-45046567 CTCTTCACTGGGCAGGGGGAGGG - Intergenic
1110915529 13:81016135-81016157 CTCTGCATTGGGATGGTGGCTGG + Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1113139546 13:107131854-107131876 CTGTGCATTTGGAAGGTGCAGGG - Intergenic
1114495631 14:23129793-23129815 AGATGCACTGGGAAAGTGGGAGG + Exonic
1117520797 14:56549662-56549684 CCATGAACTGGGAACCTGGAAGG - Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1121927734 14:97944254-97944276 CTATAGACTGTGAAAGTGGAGGG + Intronic
1122238607 14:100346977-100346999 GTAAGCACTGGGAAGGTGCCAGG + Intronic
1122580897 14:102770990-102771012 ATAAGCACGGGGAAGGTGGGAGG + Intergenic
1124356155 15:28996374-28996396 CCATGCACAGGGAGGGAGGATGG - Intronic
1124835648 15:33194256-33194278 CTTGGCACAGGAAAGGTGGAGGG - Intronic
1125327335 15:38549225-38549247 TCATGAACTGGGAAGGAGGAAGG + Intronic
1127625757 15:60778690-60778712 CTTTGAACTGGGAAGGGGTAAGG - Intronic
1128215596 15:65932251-65932273 CCATCCACTGGGATGGGGGAAGG + Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1129965912 15:79735457-79735479 CTATTCATTGGTAAGGAGGATGG - Intergenic
1130091664 15:80826314-80826336 CTATGCACCAGGAAGGCGGCAGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132789790 16:1678967-1678989 CTATCTCCTGGGAAGGTGGATGG + Intronic
1132917758 16:2362494-2362516 CAATGCACAGGGAAGGCTGAGGG - Intergenic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1137474124 16:48792012-48792034 CAATGCACTTTGAAGATGGAGGG - Intergenic
1137731700 16:50694540-50694562 CTCTGCACTGGGTAGGAGGGAGG - Intronic
1137794164 16:51201029-51201051 ATATGCACAGGGAAGGTGTTTGG - Intergenic
1138600657 16:58052052-58052074 CCATGCACTGAGAAGGAGGGGGG - Intergenic
1139288030 16:65832832-65832854 CTCTGCTCAGGGAAGGTGGTAGG + Intergenic
1139647582 16:68342740-68342762 CCAGGCACCTGGAAGGTGGAGGG - Intronic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141498250 16:84425199-84425221 GTAGGGACTGGGAAGGTGGGTGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142950937 17:3479585-3479607 TGGTGCAGTGGGAAGGTGGAAGG - Intronic
1142950955 17:3479657-3479679 TAGTGCACTGGGAAGGTAGAAGG - Intronic
1145757504 17:27403436-27403458 TTATGCTCTGGGGAGGTGGGAGG - Intergenic
1145897996 17:28471800-28471822 CTTTGCCCTGGGCAGGTGGCAGG + Intronic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1147718070 17:42521434-42521456 CAATGCACGGGGAAGATGAAAGG - Exonic
1149379880 17:56082708-56082730 TTATGCTTTGGGGAGGTGGATGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151906157 17:77050694-77050716 CTCTCCACTGGCAAAGTGGAAGG - Intergenic
1153116876 18:1668455-1668477 CTAGGCACTGGCAAGGCAGATGG - Intergenic
1153471073 18:5445923-5445945 CTATGGACTGGGGTGGAGGATGG - Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154072822 18:11168706-11168728 CTAGACACTGGGAAGGGGAAAGG - Intergenic
1157289638 18:46400361-46400383 CTATGCACTGGGAACCTGCCAGG - Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1158619997 18:59024695-59024717 GTATGCGCTGGGGAGGAGGAAGG + Intergenic
1158745302 18:60193097-60193119 CTTGGCACTGGCAAGGTGTAAGG + Intergenic
1160008880 18:75088876-75088898 CTATGGACTGAGAGGCTGGAGGG - Intergenic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1161581622 19:5083800-5083822 CTCTGCACTGGGAGGGACGATGG - Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1168157502 19:54484188-54484210 CATTGCACTGGGCAGGTGGGGGG + Intergenic
925964867 2:9055141-9055163 CTATGTACTTGGGAGTTGGAAGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929853431 2:45613940-45613962 TTAGGCACTGTGTAGGTGGAGGG - Intergenic
930430847 2:51274104-51274126 CTATGGGATGGGAAGGTGTAAGG + Intergenic
932572155 2:72943758-72943780 CTCTGGACTGGGAAGGGGGCAGG - Exonic
934085534 2:88506093-88506115 CTTTACACTGGGGAGGTGGGAGG + Intergenic
934491056 2:94762266-94762288 CAATGCACTGGGAAGGTCTCAGG + Intergenic
934571689 2:95376674-95376696 TTCTGCTCTGGGAAGGAGGAGGG + Intronic
934887421 2:98037109-98037131 CTATTCAATGGGAGTGTGGAAGG - Intergenic
935479894 2:103573936-103573958 CTATGTACTGGGTAGATTGAAGG - Intergenic
936170467 2:110167495-110167517 CGAAGTGCTGGGAAGGTGGAAGG + Intronic
936374184 2:111926860-111926882 CTATGCTCTTGGTAGGAGGAGGG - Intronic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
939564124 2:143766518-143766540 CCATTCAGTGGAAAGGTGGAAGG + Intronic
939623422 2:144447985-144448007 CTATCCACTGGGTCAGTGGATGG + Intronic
945296896 2:208179511-208179533 CCATGCAGTGGGAGGGGGGAAGG - Intronic
946159250 2:217826071-217826093 GGATGCACTGGGAAGGAGAAAGG - Intronic
946346930 2:219118460-219118482 GTAGGCAGTGGGAAGATGGAGGG + Intronic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
948098217 2:235353275-235353297 CCATTCACTGGGAAGGGGGCAGG + Intergenic
948165825 2:235861781-235861803 ATATGCACAGAGAAGGTGAAGGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1170614929 20:17940780-17940802 GTATGTACTGTGAAGGTAGAAGG + Intergenic
1170963817 20:21049038-21049060 AAAGGCACTGGGAGGGTGGAGGG + Intergenic
1171086001 20:22239017-22239039 TGATGTACTGGGAATGTGGATGG - Intergenic
1173199720 20:40945592-40945614 CTAGGCACTGGGGAGGTGGTTGG - Intergenic
1173406755 20:42773056-42773078 CTGGGCACTGGGAATGAGGATGG + Intronic
1174439731 20:50540956-50540978 CTAGGGACTGAGCAGGTGGATGG - Intronic
1174504621 20:51009315-51009337 CTAAACACTGGCAAGGGGGAGGG + Intronic
1175614703 20:60387407-60387429 CTAGAGACTGGGAAGGGGGAAGG + Intergenic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1175943627 20:62549026-62549048 CTCTGCACTGGGCAGGTGCAGGG + Intergenic
1178307675 21:31503967-31503989 ATCTGCTCTGGGAAAGTGGATGG - Intronic
1178417458 21:32415360-32415382 CTCTGCCCTGTGAAGGAGGAGGG + Intronic
1178555868 21:33589221-33589243 CCAGGCACTGGGAACGGGGAAGG - Intronic
1179514543 21:41897689-41897711 CTCTGCACTGGCAAGGAGGGGGG + Intronic
1179627622 21:42657605-42657627 CTCAGCACTGGGGAGCTGGAGGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1182145105 22:27992718-27992740 CTTTCCCCTGGGAAGGTGGCAGG - Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1184359391 22:44005673-44005695 CCATGCAGTGGAAAGGTGGGAGG - Intronic
950574437 3:13823336-13823358 CCAGGCACTGGGAAGCTGCATGG - Intronic
951459960 3:22940808-22940830 CCATGGACTGGGGAGGGGGATGG - Intergenic
951466299 3:23003892-23003914 CCAATCACTGGCAAGGTGGATGG + Intergenic
951735191 3:25855928-25855950 ATATTCTCTGGGAAGATGGAGGG + Intergenic
952435971 3:33272864-33272886 CCATGAACTGGGATGGGGGATGG - Intergenic
953846827 3:46434052-46434074 CCATGCTCTGGGAAGGGGGTGGG + Intergenic
954601838 3:51876333-51876355 GAATGCACTGGGAATGTGTAGGG + Intergenic
954719237 3:52546065-52546087 CTAGGCACTGGGAAGGAGCCTGG + Intronic
955383654 3:58461326-58461348 CTATCCTCTGGGAAGGTGAGTGG + Intergenic
956720221 3:72110854-72110876 CCATGCATTGAGTAGGTGGAAGG + Intergenic
958002215 3:87764387-87764409 CTATTCACTGGGAAGGAGAGAGG - Intergenic
959591784 3:108090459-108090481 CTAAGCACTGAGAAGGGAGAGGG + Intronic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
960959694 3:123061519-123061541 CTCTGAACAGGGAAGGTGAAAGG - Intergenic
963667868 3:148212512-148212534 CTCTGCACTGGGAAGAGGGAAGG + Intergenic
965116671 3:164499206-164499228 CTATGCTCTGGGATGGTAGATGG + Intergenic
967447897 3:189588297-189588319 CTAGGCATTTGGAAGGTGGAAGG - Intergenic
967981310 3:195066801-195066823 CTGTGCACTGGGGGGTTGGAAGG + Intergenic
968083389 3:195862893-195862915 CTCTGCACTGGGGAAGTGGACGG + Intergenic
969924781 4:10575598-10575620 CCCTGCACTGGGCAGGTGGGTGG + Intronic
970703535 4:18771513-18771535 ATGTGCACTGGCAAGGTGGCAGG - Intergenic
971972737 4:33641124-33641146 CTAGGCACTGAGAAACTGGAAGG - Intergenic
974528960 4:63082059-63082081 CTATAGACTGGGAAGGTTGAGGG + Intergenic
975373461 4:73614448-73614470 CTATGCTCTGACATGGTGGAAGG - Intronic
975376021 4:73646451-73646473 CTATGCACTTGGGAGAGGGATGG - Intergenic
977624993 4:99180378-99180400 CTCTCCACTGGGAAAGTGTACGG - Intergenic
980496896 4:133597759-133597781 ATATTCTCTGGGAAGGTGCAAGG - Intergenic
982132931 4:152246819-152246841 TTCTGCACTGAGCAGGTGGAAGG + Intergenic
985040716 4:185888938-185888960 CTATGCACTGGCAATTTGGAAGG - Intronic
986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG + Exonic
988347072 5:30050942-30050964 CTAGACACTTGGAAGATGGATGG - Intergenic
990253725 5:53943365-53943387 TCATCCACTGAGAAGGTGGAAGG + Intronic
991602831 5:68370659-68370681 TTATGCCCTGGGAAGGAGGAAGG + Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
997055457 5:130438313-130438335 CTATGCACAGGAAGGGTGGATGG + Intergenic
997860447 5:137410846-137410868 CAATGCACTGGGAGGGAGGAGGG + Intronic
1001109044 5:168880283-168880305 GTAGGCACTGAGAATGTGGATGG - Intronic
1001182644 5:169534792-169534814 CAATGCACTGTGAAGTTTGATGG - Intergenic
1001490440 5:172150994-172151016 ATATGCACTGGGGAGATGAAAGG - Intronic
1001708958 5:173762617-173762639 GCTTGCACTGGGAAGATGGATGG + Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002439007 5:179254372-179254394 CTATGAGCTGGGAAGGGGAATGG + Intronic
1003427394 6:6006864-6006886 TTATGCACTGGGAAGGCAGAGGG + Exonic
1006358979 6:33577088-33577110 CTATCCCCTGGGAAGAGGGAAGG + Intronic
1007832471 6:44649017-44649039 CCCTGGACTGGGAGGGTGGAAGG - Intergenic
1008051170 6:46901807-46901829 CTGTTCACTGGAAAGGAGGAGGG - Intronic
1008166390 6:48143911-48143933 CTACGTACTGGGAAGATGAAGGG - Intergenic
1009809050 6:68637281-68637303 TTATGCAATGGGAAGGAAGAGGG + Intronic
1009995214 6:70889118-70889140 CCAAGGGCTGGGAAGGTGGAGGG - Intronic
1010432566 6:75795386-75795408 TTATGAGCTGGGAAGGTGTATGG + Intronic
1010679166 6:78780204-78780226 CTATGCATATGGAAGGTAGATGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1012660595 6:101885641-101885663 CCCTGGACTGGGAAGGTGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015590338 6:134817010-134817032 CCATGCACTGGGAATGTGCCAGG - Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1016709748 6:147156240-147156262 GAATGCATTGGGAAGGTAGAAGG + Intergenic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1022506444 7:30911022-30911044 CGGGTCACTGGGAAGGTGGAAGG - Intergenic
1023094541 7:36646955-36646977 ATATGAACTTGGAGGGTGGAGGG + Intronic
1023871235 7:44264076-44264098 CTCAGCACTGGGCAGGTAGAGGG - Intronic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024473477 7:49787505-49787527 CTATGCTCTGGGGACATGGAGGG + Intronic
1028076138 7:86518107-86518129 CTAGGCACTGGGAGTGTGAATGG - Intergenic
1028435766 7:90801891-90801913 CTCTCCACTGGGAAGGTGATAGG - Intronic
1029490983 7:100869794-100869816 CCATGGACTGGGGAGGGGGATGG + Intronic
1029707596 7:102283969-102283991 CTGTGCTCTGGGACGCTGGAGGG + Intergenic
1031359915 7:120836953-120836975 CTATGCAGTGGGATGCTGGAGGG - Intronic
1032259015 7:130319641-130319663 GTATGGACTGGGGAGGTGGGAGG + Intronic
1032427098 7:131830985-131831007 ACATGCACTGTGAAGGTGGGAGG - Intergenic
1032641096 7:133769359-133769381 CTAACCACTGGGTAGGTGGTTGG - Intronic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035773017 8:2164643-2164665 CTTTGCACAGTGAAGATGGATGG - Intronic
1035957685 8:4100377-4100399 CTAGACACAGGGAAGGTGGAAGG - Intronic
1036751064 8:11444077-11444099 CTGTCCACTGGCAAGCTGGAAGG - Exonic
1037563146 8:20092812-20092834 CCATTCACATGGAAGGTGGAGGG - Intergenic
1037735882 8:21565633-21565655 GTGTGCACAGGGAAAGTGGAGGG - Intergenic
1039464573 8:37775349-37775371 CTATGGTCTCTGAAGGTGGAAGG - Exonic
1041903899 8:63010867-63010889 TTCTCCACTGGGAAGCTGGATGG + Intergenic
1042155906 8:65843112-65843134 CTAGCCACTGACAAGGTGGAAGG + Intergenic
1043076150 8:75702629-75702651 CTATTCTCTGGTAAGGTGAATGG + Intergenic
1047950787 8:129932980-129933002 CTATCCTCTGGGCTGGTGGAAGG + Intronic
1048134786 8:131738086-131738108 CTATGGTCTGGGAATCTGGATGG - Intergenic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1053222070 9:36320545-36320567 CTAAGCACTGGGCAGTGGGAGGG + Intergenic
1053407552 9:37890579-37890601 CCAGCTACTGGGAAGGTGGAGGG + Intronic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1060404106 9:123364614-123364636 CAATGAACTGAGAAGGGGGAGGG + Intronic
1060540571 9:124427418-124427440 AGATCCACTGGGAAGCTGGAAGG + Intergenic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1185762811 X:2701279-2701301 CCATGGACTGGGAGGGTGGATGG - Intronic
1187242874 X:17529588-17529610 GTCTGCACTGGGAATGTGGAAGG - Intronic
1187557918 X:20369671-20369693 ATAAGCACTGGCAAGGAGGATGG + Intergenic
1190890261 X:54561369-54561391 CTATGGACTTGGAAGATGCATGG - Intergenic
1194820047 X:98494307-98494329 CTATTCACTGGGAAGTGGCAGGG - Intergenic
1195485248 X:105397277-105397299 CTATGGACTGGGGAGGTGGCAGG - Intronic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1197077558 X:122371409-122371431 TCAGGGACTGGGAAGGTGGAGGG - Intergenic
1198295700 X:135284258-135284280 CCATGTACTGAGAAGGTGGTGGG + Intronic
1198422783 X:136484439-136484461 TTTTGCACTAGGAAGTTGGATGG - Intergenic