ID: 1183469308

View in Genome Browser
Species Human (GRCh38)
Location 22:37997191-37997213
Sequence CCTTCAGAGGAGGGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183469308_1183469322 17 Left 1183469308 22:37997191-37997213 CCCTCCATCCCCTCCTCTGAAGG 0: 1
1: 0
2: 5
3: 38
4: 407
Right 1183469322 22:37997231-37997253 TTCTCCCTTCTTTTCCACTTCGG 0: 1
1: 0
2: 5
3: 235
4: 6016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183469308 Original CRISPR CCTTCAGAGGAGGGGATGGA GGG (reversed) Intronic
900513389 1:3070512-3070534 CCTGCAGAGGAGGGGGCGGCGGG - Intronic
900852578 1:5155698-5155720 CCTCCAGAGGAAGGAATGGAAGG + Intergenic
900914809 1:5629262-5629284 CCTGCAGAGAATGGGATGGGTGG + Intergenic
901197906 1:7450459-7450481 GCTGGAGGGGAGGGGATGGAAGG + Intronic
901640637 1:10691374-10691396 CCTTCTCAGGAGGGGACAGAAGG - Intronic
901754596 1:11433940-11433962 CCTTCAGAGGAGATGATCAATGG + Intergenic
901814717 1:11787618-11787640 CATTCCGAAGAGGGAATGGATGG - Exonic
902353081 1:15873049-15873071 GGTTCAGAGGAGGTGGTGGAGGG + Exonic
903166012 1:21520966-21520988 GCTGCAGGGGAGGGGATGGCAGG - Intronic
903186061 1:21629653-21629675 CCTTCAGGTCTGGGGATGGATGG - Intronic
903350474 1:22713537-22713559 CCTTCAAAGCCAGGGATGGACGG + Intronic
903480859 1:23652370-23652392 CCTGCAGAAGAGGGGAAGGTGGG + Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
903908946 1:26708070-26708092 CCCTAAGTGGAAGGGATGGAAGG - Intronic
905394312 1:37657409-37657431 CCTTGAGACGAGGGGATGATTGG - Intergenic
905489084 1:38329500-38329522 GCTTCAGAGCAGGAGCTGGAGGG - Intergenic
905949450 1:41936374-41936396 CCCTGAGAGGTGGAGATGGAGGG + Intronic
906175032 1:43763755-43763777 CCATCAGAGGAGGCAATGGAGGG + Intronic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906926685 1:50125426-50125448 CTTTCAGAGTAGGGCATTGACGG - Intronic
907338459 1:53716114-53716136 CCCACAGAGGAGGGGAGGCAAGG + Intronic
907408876 1:54270935-54270957 CCTTCACAGAAGGTGAAGGAGGG + Intronic
907892873 1:58651931-58651953 GCTTCAGTGTAGAGGATGGAGGG + Intergenic
908088793 1:60664705-60664727 CCATAAGAAGAGGGGATGGCAGG + Intergenic
908180211 1:61596416-61596438 CTTTCAGAGGAAGGCTTGGAGGG + Intergenic
908357302 1:63335479-63335501 CCCTCAGTGGAGGGGGTGGGGGG - Intergenic
909232489 1:73107389-73107411 TCTACAGAGGAAGGGAGGGAGGG + Intergenic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
910262054 1:85302523-85302545 CCTTCAGCAGATGGGAAGGAGGG + Intergenic
912543027 1:110431210-110431232 CCCTCAGAGGAGTGGAGGAAAGG + Intergenic
913045983 1:115073818-115073840 CCTTCAGAGTAGGGAAGGAAAGG - Intronic
913117620 1:115711397-115711419 CTTTCAGAGGAGGAGATGAAAGG - Intronic
914712492 1:150227587-150227609 ACTTCAAAAGAGGGGAAGGAGGG + Intronic
915013899 1:152715137-152715159 CCTTCAGAGGCAGGAATGGCAGG + Intergenic
915361605 1:155289369-155289391 CCTGAAAAGGAGGGGAGGGATGG - Exonic
915623402 1:157099575-157099597 ACTTAAGAGGAAGGGAAGGAAGG + Exonic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920384618 1:205561689-205561711 CCTACAGGGGAGGGGAGGGGAGG + Intergenic
922534280 1:226368321-226368343 CCTGGAGAGGAGGGGACAGAAGG + Exonic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
923872516 1:238011262-238011284 CTTTCAGAATAGGGGAAGGATGG + Intergenic
924462115 1:244269038-244269060 ATTTCAGGGGAGGTGATGGAGGG - Intergenic
1062866032 10:855402-855424 CCCTCAGAAGAGGGAATGTAGGG + Intronic
1063194421 10:3727792-3727814 CCTTCAGCGGAGGAGATGCTGGG + Intergenic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1063320342 10:5046236-5046258 CCATAGGAGGAGGGAATGGAGGG - Intronic
1063497167 10:6520639-6520661 GCTCTAGAGGAGGGGAAGGAAGG - Intronic
1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG + Intronic
1064546587 10:16456625-16456647 CTTTCAGTGGAGAGAATGGAAGG - Intronic
1064785255 10:18887899-18887921 ACTTCAGAGGTGGGGCTTGATGG + Intergenic
1066500509 10:35989124-35989146 CCTTAAGAGGAGGGAACTGAGGG + Intergenic
1067554308 10:47257479-47257501 ATGCCAGAGGAGGGGATGGAGGG + Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1068805610 10:61191354-61191376 ACTCCAGGGGAAGGGATGGAGGG + Intergenic
1069008004 10:63339537-63339559 CTTTCAGAGGCAGGGATGGGAGG + Intronic
1069618746 10:69823358-69823380 TCTTTAGAGGTGGGGAAGGAAGG + Intronic
1069692272 10:70361719-70361741 TCTGCAGAGGATGGGATGGGAGG - Intronic
1070105001 10:73423286-73423308 ACTTGAGAGGATGAGATGGAAGG + Intergenic
1070574820 10:77670127-77670149 TCTTGAGAAGAGGGGATAGAAGG + Intergenic
1071486573 10:86106454-86106476 GCTTCAGGTGTGGGGATGGAGGG + Intronic
1072691102 10:97572774-97572796 CCTGCAGAGGCGGTTATGGACGG + Exonic
1072811970 10:98468912-98468934 CCCTCAGAGGGTAGGATGGAGGG - Intronic
1073463185 10:103678231-103678253 CACGCAGAGGAGGGGAGGGATGG - Intronic
1073861287 10:107744567-107744589 ACTGCAGGGCAGGGGATGGAAGG - Intergenic
1074044415 10:109824135-109824157 CTTTTAGGGAAGGGGATGGAGGG + Intergenic
1074113216 10:110437264-110437286 GCTTCAGAGGGTGGGAGGGACGG + Intergenic
1074224428 10:111470115-111470137 CTTAAAGAAGAGGGGATGGAAGG - Intergenic
1074982734 10:118632815-118632837 AGTTCAGAGGAGGGATTGGAGGG - Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1076271702 10:129158272-129158294 CCTTCAGATGTGGGGATGTGGGG - Intergenic
1076762354 10:132611848-132611870 CCGTCAGAGGAGGGTGTGGGAGG + Intronic
1076762369 10:132611893-132611915 CCATCAGAGGAGGGTGTGGGAGG + Intronic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077485864 11:2838175-2838197 CAGACAGAGGTGGGGATGGAAGG + Intronic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077717370 11:4595306-4595328 TCTTCAGCAGAGGGGATGGTAGG - Intergenic
1078488818 11:11750188-11750210 ATTTCAGTGGAGGAGATGGAAGG + Intergenic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1080964767 11:37201878-37201900 CTTTCAGAGGCCGGGATGGGTGG - Intergenic
1081737572 11:45414717-45414739 CCTTCAGCTGAGGGGAGGAATGG - Intergenic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1082997207 11:59263706-59263728 CCTGCAGAGGAGGAGAAGGCAGG + Intergenic
1083254251 11:61486573-61486595 CCTTCAGCCGAGGGAATGAAAGG + Exonic
1083545310 11:63545095-63545117 TGTGCAGAGGAGGGGGTGGATGG + Intronic
1083853008 11:65378814-65378836 GCTTTAGAGGGGTGGATGGAGGG - Intronic
1084490305 11:69474906-69474928 GCCTCAGAGGTGGGGGTGGAGGG + Intergenic
1084694685 11:70746385-70746407 CCTTCAGGGTGGGGGATGCAGGG + Intronic
1085081498 11:73638345-73638367 GTTCCAGAGGAGGGAATGGAGGG + Intergenic
1085738785 11:79062202-79062224 CTTTCAGAGGCTGGGGTGGATGG - Intronic
1085800134 11:79581738-79581760 TCTCCAGAGCAGGGGAGGGAGGG + Intergenic
1087253982 11:95934871-95934893 CCTCCAGAGGAGGTAATGGCTGG - Intergenic
1088504310 11:110513702-110513724 CCTTCAGAGTCGGGGAGGGAAGG + Intergenic
1088719092 11:112576259-112576281 CCTTCAGATGAGGGCAGGGGAGG - Intergenic
1088723435 11:112614036-112614058 ACTTCAGAGGCTGAGATGGAAGG - Intergenic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089097462 11:115931143-115931165 CCATCACAGCAGGGGAGGGAGGG + Intergenic
1089195508 11:116692124-116692146 CCTTCAGCTGGGGGGATGGATGG - Intergenic
1089663839 11:120004047-120004069 CCAGCAGAGGAGGGGTTGGGAGG - Intergenic
1090642548 11:128741629-128741651 TCTGCAGAGGAGGGGATAAAAGG + Intronic
1090945623 11:131426979-131427001 CCTTCAGAGGTGGAGAGGGCAGG + Intronic
1091440545 12:509229-509251 CCCGCCTAGGAGGGGATGGATGG + Intronic
1091720287 12:2808373-2808395 TCTCCATAGGAGGGGATGGGGGG - Intergenic
1091865590 12:3833493-3833515 CCTTGAGAGGCTGAGATGGAAGG + Intronic
1092147725 12:6226267-6226289 CCTTCAGAGGAGGGGGAGCCTGG + Intronic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1096264528 12:50112384-50112406 CCTGCAGACTAGGGGATGGGAGG - Intronic
1097462218 12:59875892-59875914 TTTTCAGTGGAGGGGATGGAGGG - Intergenic
1099318453 12:81114361-81114383 CCTACAGGGCAGGGGTTGGAAGG - Intronic
1099435903 12:82644558-82644580 ACTTGAGAGGTGGGCATGGAAGG + Intergenic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1101336688 12:103802927-103802949 CATTCAGAGGAGGGGATTATTGG + Intronic
1101962040 12:109258041-109258063 CCATCAGAGGAGGGCTGGGATGG - Intronic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1102978989 12:117226889-117226911 CCTTCAGAGGAAGGGATCCTGGG - Intronic
1103458576 12:121086307-121086329 CCTTCAGTGGAGGAGCTGGCAGG + Intergenic
1103506102 12:121443120-121443142 TCTCCAGAGGAGGGGCTGGAGGG + Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1106301941 13:28474656-28474678 GCTTGCGGGGAGGGGATGGAGGG + Intronic
1106996865 13:35494764-35494786 CTTTGAGAGGCTGGGATGGATGG + Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1109416403 13:62046569-62046591 CCTGCAGAGCAGGGGAGGGTGGG + Intergenic
1112510698 13:100006518-100006540 ACTTCAGAGGCTGAGATGGAAGG + Intergenic
1112562340 13:100525801-100525823 CCTGCAGAGGAAGGGCTGGGTGG + Intronic
1113249324 13:108434186-108434208 TCTTGAGAGGCGGGGATGAAGGG + Intergenic
1113400222 13:109985687-109985709 ACTTCAGAGGAGATGAAGGAAGG - Intergenic
1113457475 13:110458749-110458771 CCTGCAGAGGAGGGAGAGGAGGG - Exonic
1116395921 14:44448583-44448605 CAGTTAAAGGAGGGGATGGAAGG + Intergenic
1119123030 14:72097671-72097693 CCGGCAGAGGAGGGGGAGGAAGG - Intronic
1119522907 14:75299143-75299165 CCTTCAGTAAAGGGGAAGGAGGG + Intergenic
1119803223 14:77463824-77463846 CCATCAAAGAAGGTGATGGAAGG + Intronic
1121119927 14:91370248-91370270 CCTTCAGAAGGGGGAAGGGAGGG + Intronic
1121529891 14:94644844-94644866 CCCTCAGAGAATGGGATGGAGGG + Intergenic
1122867506 14:104614046-104614068 CCTGCAGAGGGGTGAATGGATGG + Intergenic
1124013478 15:25858339-25858361 CATTAAGAGGGAGGGATGGAGGG + Intronic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1125476231 15:40049887-40049909 CCTTCAGAGGAGGTGGGGGCTGG + Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1126858573 15:52862168-52862190 ACTTCAGAGGGAGGGAGGGAGGG - Intergenic
1127319730 15:57831315-57831337 CCCTCAGAGAAGGAGCTGGAAGG + Intergenic
1128211978 15:65909348-65909370 CCTGCAGAGGGAGGGAGGGAGGG - Intronic
1128987263 15:72230677-72230699 CTTGAAGAGGAGGGGGTGGAAGG + Intronic
1130551690 15:84893543-84893565 CCCCCAGAGGAAGGGATGAAGGG - Intronic
1130692585 15:86096817-86096839 ACTTCAGAGGAGGGGAAGCTGGG - Intergenic
1131829150 15:96343359-96343381 GCTTGAGAGGAGGGGGTGGGGGG + Intergenic
1131885243 15:96905320-96905342 CTTTGAGAGGACGAGATGGAAGG + Intergenic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1132967816 16:2669052-2669074 CCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1133745983 16:8687085-8687107 CCTTGAGAGGAAGAGATGGTGGG + Intronic
1135128343 16:19830393-19830415 CCTGCAGCAGAGGGGCTGGAGGG + Intronic
1135993204 16:27229963-27229985 CCATCAGGGGAGGGGCAGGAGGG + Intronic
1137466486 16:48714504-48714526 CCTTGAGAAGAAAGGATGGAGGG - Intergenic
1137633119 16:49962050-49962072 CCTGCAGAGAAGGGAATGCAGGG - Intergenic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139689176 16:68628807-68628829 ACTCCAGAGGCTGGGATGGAAGG + Intergenic
1139699344 16:68698086-68698108 CCTTTAGGGGAGGGGAGAGAGGG + Intronic
1139847728 16:69932601-69932623 CCTTAAGAGGAGGGGATCCCAGG - Intronic
1140298740 16:73735794-73735816 CCTACAGAGAAGGGGATGATGGG - Intergenic
1140869730 16:79095516-79095538 TCTTCAGATGAGGAGATGCAGGG + Intronic
1140917416 16:79506639-79506661 TTTTCACAGGAGGGGCTGGATGG + Intergenic
1141110789 16:81269210-81269232 CCTTCAGACGTGGGGGTGGATGG - Intronic
1141263678 16:82476245-82476267 ACTGCAGAGGAGGAGAAGGAGGG - Intergenic
1141641222 16:85342764-85342786 ACATCAGAGGAGGCGATGGTAGG + Intergenic
1141680762 16:85542374-85542396 CCTACAGAGGAGGAGACTGAAGG + Intergenic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1143410199 17:6704056-6704078 CCTGCAGAGGAGGGGCAGGGAGG + Exonic
1143711850 17:8741056-8741078 CACTGAGAGGAGGGGATGCAGGG + Intronic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144088603 17:11833218-11833240 ACTTCAGAGGCTGGGCTGGATGG + Intronic
1145167030 17:20621689-20621711 CCTCCAGGGGTGGGGAAGGATGG + Intergenic
1145984567 17:29036695-29036717 CCTTCAGACCAGGAGGTGGAGGG - Intronic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1146628675 17:34454472-34454494 CCATCAGAGGAGGTGGTGGAGGG - Intergenic
1146907005 17:36624295-36624317 ACTTCTGAGGAAGGGGTGGATGG - Intergenic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1147596894 17:41723426-41723448 ATTTCAGAGGATGGGAAGGAGGG + Exonic
1147668356 17:42162947-42162969 CTTGCAGAGGAGGGGATGCTTGG - Intronic
1147920287 17:43912152-43912174 ACTTCAGTGGAGGTGCTGGAGGG - Intergenic
1148821751 17:50364027-50364049 CCTTCAGAGCAGGGGTTGGGGGG - Intergenic
1149508061 17:57212414-57212436 CCTTCACTGGGGGGGTTGGATGG - Intergenic
1150249578 17:63698518-63698540 CCTTCCGCAGAGGGGGTGGAAGG + Exonic
1150416909 17:64995410-64995432 CCTCCCGAGGAGGGGAGGCAAGG + Intergenic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1151267385 17:72967218-72967240 TCTACAGAGCGGGGGATGGATGG - Intronic
1151285436 17:73107669-73107691 CCTTCAGAGGATGGGATGATGGG + Intergenic
1151906589 17:77053214-77053236 CCACCAGAGCAGGGGAGGGACGG - Intergenic
1151966896 17:77436251-77436273 TCTTCAGAGGAAGGGGTGGGCGG + Intronic
1153428110 18:4988196-4988218 TCTTCAGGGGGGGGGATTGATGG - Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1156221727 18:35059684-35059706 ACTTCAGAAGTGGGCATGGAGGG + Intronic
1157297528 18:46456964-46456986 CCTTCAGAGGACAGGATTGAGGG - Exonic
1157452846 18:47801200-47801222 CCTGCAGTGGGGGGGTTGGAGGG - Intergenic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1160340107 18:78082458-78082480 CCTTCAGAGGAAAGGAGGGTGGG + Intergenic
1160593280 18:79956721-79956743 CCTTCAGAGGAGGAGAGGATGGG - Intergenic
1161419966 19:4171334-4171356 CTTGCAGGGGAGGGGAGGGAGGG + Intronic
1161453961 19:4361167-4361189 CCTTAACAGGATGGGATCGAGGG - Exonic
1161502534 19:4624496-4624518 TCTCCAGTGGAGGGGAGGGATGG - Intergenic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1163104378 19:15115112-15115134 CTCCCTGAGGAGGGGATGGAGGG - Exonic
1163188622 19:15658916-15658938 ACTCCAGAGGAGGTGAGGGAAGG - Intronic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1164669051 19:30062737-30062759 CTGTCAGAGCAGGGCATGGAGGG + Intergenic
1164921314 19:32090658-32090680 GCTTCAGAGGAGGGGATGTGGGG - Intergenic
1165379441 19:35467933-35467955 TCTGCAGAGGAGGTGATGGAAGG - Intergenic
1166353044 19:42209714-42209736 CCTTCAGAGGAAGGTCTGGCGGG + Exonic
1166755616 19:45189143-45189165 GTGGCAGAGGAGGGGATGGATGG - Intronic
1166809558 19:45507377-45507399 CCTCCAGGCGAGGGGGTGGAGGG - Intronic
1168018955 19:53594962-53594984 CGCACTGAGGAGGGGATGGATGG - Intergenic
1168259535 19:55185757-55185779 TCCTCAGAGGAGTGGGTGGAAGG + Intronic
1168440446 19:56361698-56361720 CTGTCAGAGGAGGGCATGGTTGG + Intronic
1168557619 19:57356300-57356322 GCTTCAGAGGGGATGATGGAGGG + Exonic
925286314 2:2717795-2717817 CCGTCAGAGGAGGGCATGGCAGG - Intergenic
925411671 2:3643246-3643268 CCTCCACAGGAGTGGAGGGAGGG - Intronic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
927173684 2:20390847-20390869 ACTTCAGAGCTGGGTATGGAAGG - Intergenic
927186392 2:20485523-20485545 TCTTCTCAGGAGGGGAGGGAAGG - Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
927863122 2:26572795-26572817 GCTTCCGAGGAGGAGAAGGAGGG + Intronic
928238750 2:29568617-29568639 CTTACAGAGCAGGGGAGGGAAGG - Intronic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
929539977 2:42811589-42811611 CGTTCAGAGAAATGGATGGAGGG + Intergenic
929803914 2:45128048-45128070 CATTCAGGGGAGGCGGTGGATGG - Intergenic
931743126 2:65266688-65266710 CACTGAGAGGAGGGGAGGGATGG + Intronic
931939925 2:67241005-67241027 GGTTGAGAGGAGGGGAGGGATGG + Intergenic
932438640 2:71717873-71717895 CCATCAGGGGAGGGTAAGGAGGG + Intergenic
932530134 2:72521201-72521223 CCTCCAGAGGGAGGAATGGAGGG - Intronic
932569985 2:72933594-72933616 CATTCACAGAAGGGGATGGCAGG - Intronic
933808652 2:86018241-86018263 CCTTCAGAGGCCACGATGGAAGG + Intergenic
936037332 2:109123386-109123408 GCTTCAGGGGAAGGGAGGGAGGG - Intergenic
936256698 2:110921691-110921713 CCTTAAGAGAGGGGGGTGGAAGG - Intronic
936473762 2:112822180-112822202 CCCCCAGAGGAGGTGATGAAGGG - Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937846874 2:126588326-126588348 CACTCAGAGGAGTGGATTGAGGG - Intergenic
937883094 2:126882950-126882972 CCTTCAGAGGAAGGAAGGGCAGG + Intergenic
938376330 2:130809243-130809265 CCTACATAGGAGGGAAGGGAAGG - Intergenic
939306782 2:140421912-140421934 CCTGCAGACGAAGGGATGAAGGG + Intronic
939711655 2:145528526-145528548 CACTCAGAGGCAGGGATGGAAGG + Intergenic
939976529 2:148723019-148723041 CCTTCAGGGTGGAGGATGGAAGG + Intronic
940655285 2:156480603-156480625 CCTTCAGACCAGGTCATGGAAGG - Intronic
940811593 2:158249040-158249062 GCTACACAGGAGAGGATGGAGGG - Intronic
942186305 2:173427945-173427967 CCTACAGAGGATGGGCTAGAGGG - Intergenic
945561848 2:211349243-211349265 GCTTCACATGAGGGGATGGCAGG + Intergenic
945682587 2:212932024-212932046 ACTTGATAGGAGGAGATGGAGGG - Intergenic
947933589 2:233984416-233984438 CCTTCACAGGAGGGCATCGGGGG - Intronic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948676653 2:239600872-239600894 CCTTCAGAGGGGGACATGGATGG + Intergenic
948681710 2:239639688-239639710 ACTTCAAAGGAGGGGGTGGGTGG - Intergenic
1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG + Intergenic
1169191785 20:3662635-3662657 CCCTGAGTGGAGGGGATAGATGG + Intronic
1169344215 20:4817625-4817647 CCTGGAGAGGTGGGGAGGGAGGG - Intronic
1170006828 20:11678459-11678481 CCTTGAGTGGAGGTGAAGGAGGG - Intergenic
1170591876 20:17777556-17777578 CCTTCAGAGGCTGGAATGGAGGG - Intergenic
1170713154 20:18810059-18810081 TCTTCTGAGGATGTGATGGAAGG + Exonic
1171275756 20:23855569-23855591 CCCTCTCAGGTGGGGATGGAAGG + Intergenic
1171458844 20:25287186-25287208 TCTTCACAGAAGTGGATGGAGGG - Intronic
1172161234 20:32869647-32869669 ACTCCAGGGGAGGGGATCGAAGG + Intronic
1173143479 20:40505101-40505123 TCTTCAGAGGTGGCCATGGATGG - Intergenic
1173264374 20:41465875-41465897 CCTTTAGAGAACAGGATGGAAGG - Intronic
1173282764 20:41643987-41644009 CCATCAGAGGAGAGGGAGGATGG + Intergenic
1173370244 20:42428613-42428635 GCTTCACAGGAGGGGAAGGATGG + Intronic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1175278575 20:57788004-57788026 GGTGGAGAGGAGGGGATGGAGGG + Intergenic
1177790521 21:25717802-25717824 ATGTCAGAGGTGGGGATGGATGG + Intronic
1178076885 21:29020547-29020569 CCTCAAGAGAAGGGGAAGGATGG + Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180700810 22:17780676-17780698 GCTTCAGAGTGGGGGCTGGATGG + Intergenic
1180942527 22:19668659-19668681 TCTAAAGAGGAGGAGATGGAGGG - Intergenic
1181166144 22:20984084-20984106 ACATCAGAGGAGGGGCAGGAAGG - Intronic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183922054 22:41177429-41177451 CAGTCTGAGGAGGGGTTGGAGGG - Exonic
1184326765 22:43793800-43793822 CCTTCAGATGAACCGATGGATGG - Intronic
1184557475 22:45240998-45241020 CGTTCAGAGGCGGGGCGGGAGGG - Intergenic
1184640615 22:45868103-45868125 GCTTCAGAGGAGGGGCTGTGGGG - Intergenic
1185099358 22:48829448-48829470 CCTGGAGAGGAGGGTGTGGACGG - Intronic
949100834 3:143156-143178 GCGTCAGAGTAGGGCATGGAGGG - Intergenic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
949862845 3:8522240-8522262 CCTCCAGGGGAGGGGATGATTGG - Intronic
950243496 3:11393390-11393412 CCATAAGAGGAAGGGAGGGAGGG + Intronic
950831176 3:15877854-15877876 CCTTAAGGGGAGGGAGTGGATGG + Intergenic
951688954 3:25375366-25375388 CCTTCAGAGTTAGGGATTGATGG - Intronic
952967315 3:38629311-38629333 CATTCAGAGAAGGGGCTGAAGGG + Intronic
953249699 3:41233520-41233542 TCTCCATAGGAAGGGATGGAAGG + Exonic
953535659 3:43774925-43774947 CTTTCAGGGGAGAGCATGGATGG - Intergenic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
954670792 3:52290386-52290408 CCGCCAGAGGAGTGGATGCAAGG - Exonic
954959284 3:54550252-54550274 CCCTCAGCAGAGGGGATGCAGGG - Intronic
958994668 3:100890346-100890368 CCTTTAGAGGAAGGGAATGAGGG - Intronic
960971061 3:123140600-123140622 CCATCAGAGCAGGGGCTGGGAGG + Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961349526 3:126290960-126290982 CCTTCAGAGAAGGTGACAGAGGG + Intergenic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
962531307 3:136283391-136283413 CCTTCTGTGGAGGGTGTGGAGGG + Intronic
964743744 3:159992234-159992256 GCTTCTGAGGAGGGGCAGGAAGG - Intronic
964786599 3:160401801-160401823 TCTTTAAAGTAGGGGATGGAGGG - Intronic
967321479 3:188199196-188199218 CCTTGAGAGGAAGGGAGAGAGGG + Intronic
968282091 3:197484864-197484886 TCTTCACAGGAGGGAATGGCTGG - Intergenic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968641021 4:1714877-1714899 ACTTCAGAGGAGGAGGAGGAGGG - Intergenic
968763531 4:2455974-2455996 AGTTCAGAGGAGGAGATGAAAGG - Intronic
969054097 4:4390867-4390889 GCTTCACAGTAGGGGGTGGAGGG + Intronic
969175957 4:5399302-5399324 CCTGCAGAGGTGGGGAAGGAGGG - Intronic
969450547 4:7270473-7270495 CCCTCAGAGGAAGCGCTGGAGGG - Intronic
969515572 4:7646293-7646315 ACTTCAGGGGTGGGGGTGGAAGG + Intronic
969717964 4:8877533-8877555 CATGGAGAGGAGGGGAGGGATGG + Intergenic
969837836 4:9857870-9857892 GCTTCAGTGGAGGGGATAGCAGG - Intronic
970455894 4:16224239-16224261 TCTTAAAAGGAGGGGAAGGAAGG + Intronic
970888802 4:21018506-21018528 CCTGTAGAGGATGCGATGGAAGG + Intronic
971409000 4:26350623-26350645 CATTAAGAGGTGAGGATGGAGGG + Intronic
973611812 4:52643161-52643183 CAGCCAGAGGAGGAGATGGAGGG - Intronic
975642269 4:76512323-76512345 TCTCCAGAGGAGAGGAAGGAGGG + Intronic
976387667 4:84480190-84480212 CCTGCAGAGGCAGGGAGGGAAGG + Intergenic
976818939 4:89182837-89182859 CCTGGAGATGAGGGGATGGATGG - Intergenic
977788402 4:101068149-101068171 CCTTCAGAAGATGGGAAAGAGGG + Intronic
980132827 4:128832683-128832705 GATTCAGAGGAGGGGAGGGCAGG + Intronic
981453544 4:144927595-144927617 CTATCAGAGGATGGGGTGGAGGG - Intergenic
981762567 4:148210046-148210068 CCAGGAGAGGAGGGAATGGAAGG - Intronic
981790467 4:148530596-148530618 CTTTCAGAGGAGGGGTTGTGGGG - Intergenic
982167530 4:152628304-152628326 CCCTCAGAGGCAGCGATGGATGG + Exonic
982842890 4:160214895-160214917 CCACTAGAGGAGAGGATGGAGGG - Intergenic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985249102 4:188005361-188005383 CCTTCTGAGGCTGGGAGGGAAGG + Intergenic
985693522 5:1326766-1326788 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693603 5:1327259-1327281 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693616 5:1327346-1327368 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693621 5:1327375-1327397 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693635 5:1327462-1327484 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693646 5:1327520-1327542 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693755 5:1328245-1328267 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985693760 5:1328275-1328297 CCTGTAGAGGAGGAGCTGGATGG - Intronic
985890244 5:2709866-2709888 GCTGGAGAGGAGGTGATGGAGGG - Intergenic
986174847 5:5343313-5343335 ACTTCAGGAGAGTGGATGGAAGG - Intergenic
986737125 5:10676094-10676116 CCTTCACTGGAGGGGAGGGTAGG - Intergenic
989322321 5:40150868-40150890 TCTACAGAGCAGGGTATGGAAGG - Intergenic
991311456 5:65247672-65247694 CCTTTAGAGGAGGAGAGGAAAGG - Intronic
993407669 5:87531680-87531702 CCTCCAGAAGAGGATATGGATGG + Intergenic
995745098 5:115394346-115394368 TCTTCAGAAGCGGGGATTGATGG - Intergenic
995856814 5:116601168-116601190 CCCTCAGAGGAGGGAGAGGAGGG - Intergenic
997343105 5:133162181-133162203 CCTCCAGAGGCTGAGATGGAGGG - Intergenic
998619085 5:143774638-143774660 CCATCAGAGTTGGGGAGGGAAGG - Intergenic
999135111 5:149313546-149313568 CCTTGAGAGGAGGGGCAGCATGG - Intronic
999278198 5:150346522-150346544 CTTTCAGAGGTGGTGATGGTGGG + Intergenic
999517822 5:152318613-152318635 GCTTTAGAGGAGAGCATGGAAGG - Intergenic
1002375577 5:178786641-178786663 CTTCCAGAGGCGGGGATGGCTGG + Intergenic
1002912431 6:1500187-1500209 CCTTCAGAGGACGATATGGAGGG + Intergenic
1003496218 6:6665821-6665843 CCTTCATAAGAGGAGATGGCAGG - Intergenic
1004241040 6:13922931-13922953 CCTTCAGCTGAGGGCAGGGATGG + Intergenic
1006337365 6:33427752-33427774 CCTGCTCAGGAGGGGATGGTGGG + Intronic
1006438594 6:34039894-34039916 CCCACTGAGGAGGGGATGGGGGG - Intronic
1006441949 6:34058576-34058598 CCCTGAGAGGAGGGGATTCAGGG + Intronic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1013042341 6:106448276-106448298 CCTTGAGAGGAGGAGAATGATGG - Intergenic
1014957126 6:127634442-127634464 CTTTCAGAGGATGGGAGGGGAGG + Intergenic
1016372951 6:143393297-143393319 CCTGGAGAGGAGGAGAAGGAAGG + Intergenic
1017551406 6:155512439-155512461 CTTTCAGAGGACGTGGTGGAAGG - Intergenic
1017885650 6:158597463-158597485 CCCTCAGTGGAAGGGATGGAAGG + Intronic
1017984213 6:159428349-159428371 GCTTAAGAGGAGGGTCTGGAAGG + Intergenic
1018851057 6:167590425-167590447 CCTGCATAGGAGGTGATGGTGGG - Intergenic
1019155271 6:170034288-170034310 CCTGGAGAGAAGGGGAGGGAAGG + Intergenic
1019610642 7:1935108-1935130 CCGTGACAGCAGGGGATGGAAGG + Intronic
1020410486 7:7886733-7886755 GCTTTAGAGTAGAGGATGGATGG - Intronic
1021439390 7:20660858-20660880 AATGGAGAGGAGGGGATGGAAGG - Intronic
1022339637 7:29456192-29456214 CGTTCAGAGGAGCAGATGGGAGG - Intronic
1024164837 7:46720618-46720640 ACTGCAGAGAAGGGCATGGAAGG - Intronic
1024863909 7:53880825-53880847 CCATCAGTGGTGGGGCTGGAAGG + Intergenic
1025170679 7:56753876-56753898 ACTGGAGAGGAAGGGATGGATGG + Intergenic
1025701205 7:63821823-63821845 ACTGGAGAGGAAGGGATGGATGG - Intergenic
1026819611 7:73537989-73538011 ACTTCCGAGGAGGGCAGGGAGGG + Exonic
1029433036 7:100544558-100544580 GTGACAGAGGAGGGGATGGAGGG - Intronic
1029604646 7:101591121-101591143 CATTTAGAGGAGGGGATGGGGGG - Intergenic
1031063223 7:117075514-117075536 CATCCAGAGGAGTGGATGGCAGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1033153286 7:138935053-138935075 TCTTTAGAGGAGGAAATGGAAGG - Intronic
1033710841 7:143941952-143941974 CCTTGAGAGGAGAGGACGGGAGG - Intergenic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1035464411 7:159065277-159065299 ACTGCAGGGGAGGGGAGGGAGGG - Intronic
1036757010 8:11477402-11477424 CCTTCAGAGAAGGGGCTGAGAGG - Intergenic
1039545768 8:38410068-38410090 TCCTCAGTGGAGGGAATGGAAGG + Intergenic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1043745218 8:83866869-83866891 TTTTCTGAGTAGGGGATGGATGG + Intergenic
1043861949 8:85328586-85328608 CCTTCAGAGGTTGGGTTGGGCGG + Exonic
1044748993 8:95398608-95398630 CCTTCAGAAAAGGGGATGGTGGG - Intergenic
1044986211 8:97758417-97758439 CAGTCAGAGGAGGGAATTGAGGG - Intergenic
1045103331 8:98866984-98867006 TCTTGACAGGAGGGGAGGGAGGG + Intronic
1046124077 8:109882370-109882392 CCATGAGGGGAGGTGATGGATGG + Intergenic
1048054987 8:130854842-130854864 CCTACAGAGGGAGGGAGGGAAGG - Intronic
1048424840 8:134313440-134313462 ACCTCAGAGAAGGGAATGGAAGG + Intergenic
1048465814 8:134664070-134664092 CCTGCACAGGAGGTCATGGAAGG + Intronic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1049034372 8:140062781-140062803 GCTTCTGAGGAAGGAATGGAGGG + Intronic
1049239860 8:141531834-141531856 CCCTCAGAGCAGGGGCAGGAAGG + Intergenic
1049469791 8:142770187-142770209 CCCTCAGAGGCTGGGAAGGAAGG + Intronic
1050002208 9:1089506-1089528 GCTTCAGAGGAAGCAATGGAAGG + Intergenic
1050151312 9:2621896-2621918 GCTGCAGAGGAGGGGAGGCAAGG - Exonic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1053487916 9:38474442-38474464 TCTCCAGAGGAGGGAATGCACGG - Intergenic
1055581500 9:77711192-77711214 CCTTCAGAGAAGGAGGGGGAGGG - Intergenic
1056850117 9:90076624-90076646 GTTCCAGAGGAGGGGAGGGATGG - Intergenic
1057215648 9:93227013-93227035 CCCTCAGAGGAGGGCTTGGCAGG - Intronic
1057582946 9:96303588-96303610 CCTTCTGGGGGTGGGATGGAGGG + Intergenic
1057915130 9:99049596-99049618 CCTCCAGAGGAAGGAAAGGAGGG - Intronic
1058711291 9:107681702-107681724 CCTTCAGAGGCTGGGAGGGGAGG + Intergenic
1060256971 9:122039784-122039806 TTTTCAGAGGAAGGGATGTATGG - Intronic
1060517378 9:124274321-124274343 ACTTCAGAAGAAGGGAAGGAGGG + Intronic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1061055464 9:128220127-128220149 CCTCAAGAGGAGGGGAAGGGTGG - Intronic
1061802950 9:133121975-133121997 CCCTCAGAGGAGGGGAAGCCAGG + Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062318178 9:135978311-135978333 GCTGCTGAAGAGGGGATGGAGGG - Intergenic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062318284 9:135978610-135978632 GCTGCTGAGGCGGGGATGGAGGG - Intergenic
1062358667 9:136177198-136177220 CCATCTGAGGAGGGCAAGGATGG + Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062627196 9:137448656-137448678 CCTTCAGAGGAGGCTCTGGGTGG - Exonic
1203361525 Un_KI270442v1:221582-221604 GCCTCAGCGGTGGGGATGGAGGG - Intergenic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1187056955 X:15749775-15749797 CCCTCAGTGGAGGGCAGGGAGGG - Intronic
1187272766 X:17793649-17793671 CCTTCAGTGGAAGGGAAGGATGG + Intergenic
1187606249 X:20886276-20886298 CATCCAAAGGAGGGGATGGAAGG + Intergenic
1187984601 X:24796740-24796762 CATTCAGCAGAGGGGATGTAAGG - Intronic
1188146406 X:26619015-26619037 CATTCTAAGTAGGGGATGGAGGG + Intergenic
1188192281 X:27187004-27187026 CCTTCAGAAGATGGGGTTGATGG - Intergenic
1189641370 X:43075552-43075574 GGGTAAGAGGAGGGGATGGAAGG + Intergenic
1189993329 X:46614948-46614970 TCTCTAGAGGAGGAGATGGAAGG + Intronic
1190161212 X:48032708-48032730 CCTTCAGTGGAGGACATGGGCGG - Intronic
1190598441 X:52067828-52067850 TCTTCCGAGCAGGGGAGGGAAGG + Intronic
1190610383 X:52186245-52186267 TCTTCCGAGCAGGGGAGGGAAGG - Intronic
1191890070 X:65930897-65930919 CCTTCAGAACAGGCGATAGATGG - Intergenic
1191927220 X:66326528-66326550 GCTCCAGAGGAAGGGAAGGAGGG + Intergenic
1192234542 X:69287310-69287332 CCCAGAGAGGAGGGGAGGGAGGG + Intergenic
1192560688 X:72126154-72126176 CTTTAAGAGGAAGGGAGGGAGGG - Intergenic
1198068160 X:133120459-133120481 ACTACAAAGGAGGGGATGGGCGG + Intergenic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1200011396 X:153123406-153123428 CCTTCAGAGCGGGGGGTGCAGGG + Intergenic
1200028204 X:153276516-153276538 CCTTCAGAGCGGGGGGTGCAGGG - Intergenic
1200179408 X:154141189-154141211 CCTTCTGAGGGTGGGATGGCTGG - Intergenic