ID: 1183470759

View in Genome Browser
Species Human (GRCh38)
Location 22:38005216-38005238
Sequence GAGTGAAGGACGTTGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183470759_1183470763 -3 Left 1183470759 22:38005216-38005238 CCTATTTCCAACGTCCTTCACTC No data
Right 1183470763 22:38005236-38005258 CTCCAGCCTCCCGAGTAGCTGGG 0: 69
1: 5242
2: 120471
3: 301681
4: 221779
1183470759_1183470766 5 Left 1183470759 22:38005216-38005238 CCTATTTCCAACGTCCTTCACTC No data
Right 1183470766 22:38005244-38005266 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1183470759_1183470762 -4 Left 1183470759 22:38005216-38005238 CCTATTTCCAACGTCCTTCACTC No data
Right 1183470762 22:38005235-38005257 ACTCCAGCCTCCCGAGTAGCTGG 0: 8
1: 690
2: 15532
3: 154627
4: 312493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183470759 Original CRISPR GAGTGAAGGACGTTGGAAAT AGG (reversed) Intronic
No off target data available for this crispr