ID: 1183476964

View in Genome Browser
Species Human (GRCh38)
Location 22:38041050-38041072
Sequence GCCTCCTGGAAAATAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183476964_1183476972 30 Left 1183476964 22:38041050-38041072 CCCTGTGTTATTTTCCAGGAGGC 0: 1
1: 0
2: 2
3: 23
4: 194
Right 1183476972 22:38041103-38041125 GCCCCGTGAACAATGCATGGTGG 0: 1
1: 0
2: 0
3: 2
4: 57
1183476964_1183476971 27 Left 1183476964 22:38041050-38041072 CCCTGTGTTATTTTCCAGGAGGC 0: 1
1: 0
2: 2
3: 23
4: 194
Right 1183476971 22:38041100-38041122 GAAGCCCCGTGAACAATGCATGG 0: 1
1: 0
2: 0
3: 13
4: 163
1183476964_1183476969 -8 Left 1183476964 22:38041050-38041072 CCCTGTGTTATTTTCCAGGAGGC 0: 1
1: 0
2: 2
3: 23
4: 194
Right 1183476969 22:38041065-38041087 CAGGAGGCGGCGGCTCAGAGAGG 0: 1
1: 0
2: 4
3: 62
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183476964 Original CRISPR GCCTCCTGGAAAATAACACA GGG (reversed) Intronic
900661892 1:3788886-3788908 GCCTGCTGGGGAAGAACACAAGG + Intronic
905393087 1:37650642-37650664 GCCTATTGGAATCTAACACAAGG + Intergenic
908809242 1:67962422-67962444 GCCTCCTGGAGTATAGAACAGGG + Intergenic
911389730 1:97225813-97225835 AACTCCTGGAAGAAAACACAGGG - Intronic
911609915 1:99949571-99949593 GGTTCCTGGGAAATAACACTTGG + Intergenic
911833696 1:102587884-102587906 GCCTCCTGAGAAATACCTCAAGG - Intergenic
914939369 1:152009012-152009034 GACTCCTAGACAATAACATAGGG - Intergenic
916362889 1:163990659-163990681 GCCTCCTGGAAGTTCACACTGGG + Intergenic
917353670 1:174104424-174104446 GATTCCTGGAAAATAACGAAAGG + Intergenic
1063588277 10:7372638-7372660 GTCTCCTGGAAAACACCTCAGGG + Intronic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1066484194 10:35827763-35827785 GCTACCTGGTAAATAGCACATGG + Intergenic
1070530645 10:77334082-77334104 GCCTGGTGGAAAATCAAACAAGG - Intronic
1070669053 10:78365298-78365320 GCTACCTGGAACAGAACACACGG - Intergenic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1073687029 10:105765964-105765986 AGCTCCTGGAGATTAACACATGG + Intergenic
1073934653 10:108616660-108616682 GTCTTCTGGAATCTAACACAGGG + Intergenic
1076838338 10:133032406-133032428 GCCACCTAGAAAGTAACAGAGGG + Intergenic
1078853208 11:15182855-15182877 GCCTTTTGGAAAATAATAGAAGG - Intronic
1078858869 11:15228993-15229015 GGCTCCTGGAAAATACCTCCTGG - Intronic
1078866330 11:15301414-15301436 GAATCATGGAATATAACACACGG - Intergenic
1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG + Intergenic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1085138197 11:74113782-74113804 GCCTCCAGTAAAATTACAGATGG - Exonic
1087737462 11:101851219-101851241 CCTCCCTGGAAAATGACACATGG + Intronic
1088640926 11:111872129-111872151 GTTTCCTGGTAAATAAAACAAGG - Intergenic
1091533952 12:1387825-1387847 AGCTCCAGGAAACTAACACATGG + Intronic
1093148720 12:15597413-15597435 GCCTCCTGGAAGCACACACACGG - Intergenic
1095977092 12:47947188-47947210 GCATCCTGGAAACTCACGCAGGG + Intergenic
1096881594 12:54677388-54677410 GGCTCCTAGAAGACAACACAGGG + Intergenic
1098397627 12:70038369-70038391 GCCTCCTGCAAAATGATGCATGG - Intergenic
1100077046 12:90797817-90797839 GTCTCCTGGAAAAAAAAAAAAGG - Intergenic
1100187076 12:92150300-92150322 GCCCACTGGAAAATGAAACAAGG + Intergenic
1102948788 12:117014072-117014094 GCCTGTTGGAAAATTTCACAAGG - Intronic
1103059416 12:117846916-117846938 CCCTCCTGGCAACTGACACAGGG + Intronic
1103224132 12:119272283-119272305 TCATCCTGGAAAATAACAAATGG + Intergenic
1103347802 12:120263088-120263110 GCCTCCTGGTCCCTAACACAGGG - Intronic
1104495274 12:129231218-129231240 GTGTCCTTGAACATAACACAGGG + Intronic
1104675948 12:130712523-130712545 GTCTCCAGGGGAATAACACAAGG + Intronic
1110002907 13:70228589-70228611 GCCTCCTAGAAAATAGAACTAGG - Intergenic
1112151615 13:96770942-96770964 GCCTCTTTTAAAAGAACACAGGG + Intronic
1113073334 13:106443848-106443870 GTCTCCTGGAAAAGCACACGGGG - Intergenic
1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG + Intronic
1114258710 14:21022901-21022923 GCCTCCTGGAGAGACACACACGG + Exonic
1115785923 14:36826208-36826230 GCCTCCTTGAATAGTACACAAGG + Intronic
1116247129 14:42429565-42429587 GCCTCCTGGATAATATCACGGGG + Intergenic
1116891542 14:50273509-50273531 GACTCCTGGAAGAAAACACAGGG + Intronic
1123986118 15:25647751-25647773 GCCTCCACAAACATAACACACGG + Intergenic
1126296383 15:47141367-47141389 CCCTCCTTGAAAATAAAACAGGG + Intergenic
1130081001 15:80733358-80733380 GCCTCCTTGAGAATTACACAAGG - Intronic
1130988010 15:88857352-88857374 GCCTTCTGGAAAAGAAGACTTGG + Exonic
1131076740 15:89500037-89500059 GCTTCCTGGAATAAAACAAAGGG - Intergenic
1131596402 15:93802656-93802678 CCCTCCTGGAAATTAACCCCAGG - Intergenic
1133477712 16:6139397-6139419 GTCTCCTGGAACATCCCACATGG - Intronic
1134318933 16:13145077-13145099 GCCACCTGGCAAGGAACACATGG - Intronic
1135126428 16:19813829-19813851 GCCTCCTCCCAAACAACACAAGG - Intronic
1136556675 16:31011056-31011078 GCCTCCTGCAAGAACACACATGG - Intergenic
1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG + Exonic
1137854431 16:51779547-51779569 GCCTTCTGCAAAAGAACACTTGG - Intergenic
1138111638 16:54328960-54328982 GCCTCCTGGAGGATGAGACATGG - Intergenic
1138457831 16:57131570-57131592 GCCTCCTTGTAAATGTCACAGGG + Intronic
1142721324 17:1777821-1777843 GCCTGCTCGTAAACAACACATGG + Intergenic
1143879656 17:10020182-10020204 GCCCCCTAGAAAATCACTCACGG + Intronic
1146180580 17:30695728-30695750 ACTTCCTGGAAAATAGCCCAGGG - Intergenic
1149137403 17:53385131-53385153 AACTCCTGGAAGAAAACACAGGG + Intergenic
1150999762 17:70361284-70361306 GCCTCAAGGAAAATAACTTAGGG + Intergenic
1151085893 17:71380284-71380306 GTCTCCTGGAAGCTAACACCGGG - Intergenic
1152450579 17:80376714-80376736 GCTTCCTGTGAAATAACAAAGGG - Intronic
1153135551 18:1913376-1913398 TCCTGCTGGAAAATATCTCAAGG - Intergenic
1153195412 18:2590613-2590635 CCCACCTGGATAATAATACAGGG + Intronic
1156147756 18:34206443-34206465 GCCTGCTGGAAATTAATTCATGG + Intronic
1156849739 18:41712533-41712555 AATTCCTGGAAAAAAACACAAGG + Intergenic
1156922165 18:42534996-42535018 GCCTGCTGTAAAATAACACTGGG + Intergenic
1157585907 18:48801013-48801035 GCCTCCTTGGGAACAACACAAGG + Intronic
1158007012 18:52684043-52684065 GCGTCATGGAAATAAACACATGG - Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161363750 19:3867256-3867278 ACCAGCTGGAAACTAACACAAGG + Intronic
1162722920 19:12673080-12673102 GGCTCCTGGACAAAGACACAGGG + Exonic
1163083572 19:14962211-14962233 GCTTCCTGGAAAATGTCACTCGG - Exonic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
925607890 2:5677408-5677430 GCCTAATTGAAAATAAGACATGG - Intergenic
926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG + Intergenic
927060279 2:19412299-19412321 GCCTCTTGGAAAATCTGACATGG + Intergenic
931690474 2:64831223-64831245 GCTTCCTGGAAAACAGCACAAGG - Intergenic
932342465 2:70974964-70974986 TCCTCCTGGAAGACAGCACAGGG + Intronic
933512735 2:83261801-83261823 GCCTCCTGGAATACATAACATGG + Intergenic
934855729 2:97728431-97728453 GGCTCCTGGAAAATTAGGCAAGG + Intronic
935853723 2:107251195-107251217 AACTCCTGGAAGATAACACAAGG - Intergenic
936651762 2:114435819-114435841 ACCTCCTGGAAAACAAAATAAGG - Intergenic
937469289 2:122161471-122161493 GCCACTTAGAAAAAAACACATGG - Intergenic
938509960 2:131930968-131930990 GACTTCTGGAAATTAATACAAGG + Intergenic
938901330 2:135800805-135800827 GACTCCTGGAAACATACACATGG + Exonic
939961781 2:148571609-148571631 GACTCCTGCAAACTATCACAAGG - Intergenic
940030543 2:149257413-149257435 GCCTCCTGGAAATTCAGACTGGG - Intergenic
940083079 2:149827020-149827042 GGCTCCTGGAAAATTAAAGATGG - Intergenic
943788529 2:191905947-191905969 GGCTCCTGGAAAAGAACATGAGG + Intergenic
1170418617 20:16170533-16170555 GGCACCTGGCCAATAACACACGG - Intergenic
1170585803 20:17732989-17733011 CCCTCCTGGAAGATGCCACAGGG + Intronic
1170934722 20:20799729-20799751 GCCTCCTGAGCAATAACAAATGG - Intergenic
1172785300 20:37464644-37464666 GCATCCTGGAAAAAAACATGGGG - Intergenic
1173746180 20:45438950-45438972 GCTTCCTTGAAAGTAAAACAAGG - Intergenic
1176238773 20:64066388-64066410 GCCTACTGGAGGAGAACACAAGG - Intronic
1176960246 21:15151442-15151464 AGCACCTGGATAATAACACAAGG + Intergenic
1177981567 21:27921415-27921437 GACTTCTGGAAATTAATACAAGG - Intergenic
1179156787 21:38857929-38857951 GCTTTCTGGAAAAAAAAACATGG + Intergenic
1179990609 21:44946622-44946644 GCCTCCTGGAACACACCTCAGGG - Intronic
1181872141 22:25908167-25908189 GCATCCTGGAAGATCACAAATGG - Intronic
1181876417 22:25944167-25944189 ACCTGCTGGAAAATAAGACCAGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183583241 22:38737933-38737955 GCTTCCTGGAAAAGGACACCAGG - Intronic
950990496 3:17433174-17433196 GCCACCTGAAAGATGACACAAGG + Intronic
951257400 3:20466113-20466135 AACTCCTGGAATATAACATATGG - Intergenic
952264138 3:31769054-31769076 GCCCCATGGAAAATAAGAAAGGG + Intronic
953197401 3:40747192-40747214 GCCTTCTGGCCAATCACACAAGG - Intergenic
953636331 3:44668277-44668299 GAATCCTGGAAAACCACACATGG - Intergenic
954170253 3:48795989-48796011 GTCTCTTTGCAAATAACACATGG - Intronic
955917370 3:63920124-63920146 GCTTACTGGAAAGTAACACCTGG + Intronic
956158959 3:66327352-66327374 GACTCCAGGATAAAAACACAAGG + Intronic
960900729 3:122551728-122551750 TGCTCCAGGAATATAACACATGG + Intronic
961953967 3:130781064-130781086 TTCTCTTGGAAAATAACACATGG - Intergenic
963848944 3:150188745-150188767 GCCTCCTAGAAGATAACATAGGG - Intergenic
965616103 3:170594011-170594033 GCCTCCTCTACAATAACACAGGG - Intronic
966997870 3:185301556-185301578 CACTCCTGGAAGATAACACAGGG - Intronic
967200369 3:187067470-187067492 CCCTCCTGGAACTTTACACATGG - Intronic
967513830 3:190342852-190342874 AACTCCTGGAAAAAAACATAGGG + Intronic
968241251 3:197088370-197088392 AGCTCCTGCAAAATAAAACAGGG + Intronic
969070350 4:4532499-4532521 GACTCAGGGAAAATATCACAAGG + Intronic
969907164 4:10407868-10407890 GGCTCCTGAAAAAAACCACATGG + Intergenic
970000236 4:11357678-11357700 GCCTCCTGGAAGAAAGCACAGGG - Intergenic
970180604 4:13388412-13388434 AACTCCTGGAAGAAAACACAGGG + Intronic
971008148 4:22398743-22398765 GACTCTTGTATAATAACACAGGG + Intronic
971083408 4:23242082-23242104 ATTTCCTGGAAAATAAAACAGGG - Intergenic
974435655 4:61854256-61854278 TCCTACTAGAAAACAACACATGG - Intronic
976611213 4:87032568-87032590 GGCTCCTAGCAAACAACACATGG - Intronic
979273996 4:118794223-118794245 GTCTTCTGGAAAATAAAACCTGG - Intronic
979813338 4:125066025-125066047 AACTCCTGGAAGAAAACACAGGG + Intergenic
983172354 4:164550181-164550203 GCCTCCTGGAACATAGAACAGGG + Intergenic
983353877 4:166630684-166630706 GGCTCTTGGAAGATAACAGAGGG + Intergenic
986865731 5:11984383-11984405 GTCAACTGGAAAATGACACATGG + Intergenic
986917194 5:12635513-12635535 GACTCCAGAAAAATAACAAATGG - Intergenic
989135669 5:38151956-38151978 GCCTCCTGGTAAACATCACTGGG - Intergenic
989790017 5:45387542-45387564 TACTCCTGGTAAATAAGACACGG + Intronic
990615478 5:57503081-57503103 GCTTCCAGGAAACTACCACAAGG + Intergenic
994678734 5:102859242-102859264 GTCTTCTGGGCAATAACACATGG - Intronic
995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG + Exonic
995755620 5:115500757-115500779 AACTCCTGGAAGAAAACACATGG - Intergenic
997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG + Exonic
999660813 5:153860948-153860970 GTCTCCTGAACAATAGCACAAGG + Intergenic
1000875733 5:166635907-166635929 GCCTTCTGAAAAATAACAAGAGG + Intergenic
1001727943 5:173923050-173923072 GCCTTCTGAGAAATAACAAAAGG + Intronic
1001786110 5:174414983-174415005 GACTCCTGGAAAATATAAAAAGG + Intergenic
1004150972 6:13119838-13119860 GATTCCTGGAAAATGACACAGGG - Intronic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1005267088 6:24123475-24123497 CCCTTCTGGAAAACAACCCAGGG + Intergenic
1007270284 6:40630903-40630925 GCCTCCTGGATAAAACCAGAAGG - Intergenic
1008391754 6:50960036-50960058 ACCTCATGGAACATAACCCAGGG - Intergenic
1008726159 6:54422937-54422959 GACTCCTGGACAAAAACATAGGG + Intergenic
1009394135 6:63177791-63177813 GACTCTTGGAAATTAACACCTGG - Intergenic
1009613617 6:65977686-65977708 GCCTCCTGGAGCATAAAGCAGGG - Intergenic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1011501515 6:87995662-87995684 GCATCCAGCAAAAGAACACAGGG + Intergenic
1011553809 6:88554179-88554201 TCCTCCAGAAAAATAACAAAGGG + Intergenic
1011752364 6:90465999-90466021 TCCTCTTGGAAAATAAATCATGG + Intergenic
1013587184 6:111590031-111590053 GGCCACTGGAAAATAACAAAAGG - Intronic
1015201552 6:130587236-130587258 CCTTCCTGAAGAATAACACAAGG - Intergenic
1015579373 6:134706845-134706867 GCATCCTGTCACATAACACATGG + Intergenic
1015970554 6:138739154-138739176 GCCTCCTGGAAAAAAAAATATGG + Intergenic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1019488590 7:1300725-1300747 CCCTCCTGAAAAAAAACACAGGG + Intergenic
1020614304 7:10439447-10439469 TTCTCCTGGAAAAAAATACAGGG + Intergenic
1021350600 7:19589214-19589236 TCCTCCTGGAAAAGACCAGAGGG - Intergenic
1022122911 7:27327057-27327079 GCCTCCTGAAAAATCACAGTGGG + Intergenic
1022796279 7:33734082-33734104 TCTTCCTGGAACATAACAAATGG - Intergenic
1024192830 7:47030304-47030326 GCTTCCAGGAATATAATACACGG + Intergenic
1024404561 7:48963093-48963115 GCATCCTGGAAAGAAACAGATGG - Intergenic
1027503740 7:78988561-78988583 GAGTACTGCAAAATAACACAGGG - Intronic
1027670221 7:81087290-81087312 GCCTCATGGAAAATAAAAGGTGG - Intergenic
1030958867 7:115889525-115889547 GCCTCCGGGAAATTCAAACAGGG + Intergenic
1031651174 7:124291640-124291662 AACTCCTGGAAAAAAACATAAGG - Intergenic
1031725001 7:125227606-125227628 AACTCCTGGAAAATAGCATAGGG - Intergenic
1032596005 7:133241051-133241073 GCCTCTTGGGAAAAAACACATGG - Intergenic
1034344025 7:150374870-150374892 GGCTCCTGAAAAACAACTCAAGG + Intronic
1035007181 7:155674534-155674556 GCTTTCTGGAAAGAAACACAGGG - Intronic
1035624626 8:1061651-1061673 GCTCCCTGGAAAACACCACAGGG - Intergenic
1038397994 8:27261282-27261304 GCCTCCTGGAGAACCACACGGGG - Intergenic
1039743705 8:40404999-40405021 GGCTCCTGAAAAACAACTCAGGG + Intergenic
1040420395 8:47234497-47234519 GACTCCTAGAATATAACATAGGG + Intergenic
1041272974 8:56126600-56126622 GCTTCCTGAAAAAGAATACATGG + Intergenic
1041993669 8:64026556-64026578 ACCTGCAGGAAAATAACCCAGGG - Intergenic
1042316306 8:67429977-67429999 GCCCCCTGGAAAATAATTCTTGG - Intronic
1043357954 8:79435853-79435875 ACCTCCTGATAAATAACAGAAGG - Intergenic
1043860359 8:85309434-85309456 ACTTCCTGGAAAATATCAGATGG + Intergenic
1044429558 8:92093083-92093105 GCCTTCTGAAAATTTACACATGG + Intronic
1045908427 8:107376354-107376376 CTCTCCTGGAAAAGAACTCAGGG - Intronic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1046884404 8:119348015-119348037 ATCTCCTGGAAAATAACATAGGG - Intergenic
1051027395 9:12629779-12629801 TCCTCATTCAAAATAACACAAGG + Intergenic
1054978266 9:71173616-71173638 TCCTCATGGAAAATTTCACAAGG + Intronic
1055394948 9:75864044-75864066 TCTTCTTGGGAAATAACACAGGG - Intergenic
1057438424 9:95063559-95063581 GCCACCAGCAAAACAACACAGGG - Intronic
1060470751 9:123946161-123946183 GCCTCCTGGAGAAAACAACAAGG - Intergenic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1185924033 X:4126806-4126828 AACACCTCGAAAATAACACAGGG - Intergenic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1187020697 X:15378294-15378316 GCCCACAGGAAAATAGCACAGGG + Intronic
1187096758 X:16156864-16156886 GCCGCCTGCAATATAACAAAGGG - Intergenic
1188125849 X:26367900-26367922 AAGTCCTGGAAAAAAACACAGGG - Intergenic
1189384663 X:40527539-40527561 GCATTCTGCAAAATACCACATGG - Intergenic
1190630623 X:52381818-52381840 GGCTCCTGGCAAAAGACACAGGG - Intergenic
1190642858 X:52496544-52496566 GGCTCCTGGCAAAAAACACAGGG - Intronic
1190644815 X:52516323-52516345 GGCTCCTGGCAAAAAACACAGGG + Intronic
1190650225 X:52562514-52562536 GGCTCTTGGCAAATGACACAGGG + Intergenic
1192589221 X:72346142-72346164 GGCTCCTGGAAAGGACCACAGGG + Intronic
1194029273 X:88790591-88790613 CTCTCATGGAAAATAACAAAAGG - Intergenic
1195942648 X:110178469-110178491 TCTTCCTGAAAAAGAACACATGG - Intronic
1196347536 X:114681985-114682007 TCCTCCTGGAAATTAAAATAAGG - Intronic
1199882469 X:151985424-151985446 GCCTCCTGGAAACTTCCACTTGG - Intergenic
1200118425 X:153779288-153779310 GCCTGCTGGAAAATCACATCCGG + Exonic
1201304350 Y:12537755-12537777 CACTCCTGGAAAAGAACGCAGGG - Intergenic
1201683258 Y:16672251-16672273 GCATCATGGAATATAACACAAGG - Intergenic