ID: 1183478947

View in Genome Browser
Species Human (GRCh38)
Location 22:38052457-38052479
Sequence AAGACAGCTCCTGGAGCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183478947_1183478956 12 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478956 22:38052492-38052514 CCGGGTGGCAGCACTTCCCCAGG No data
1183478947_1183478950 -7 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478950 22:38052473-38052495 CTGTCTTTCCTAATGGCCACCGG No data
1183478947_1183478952 -3 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478952 22:38052477-38052499 CTTTCCTAATGGCCACCGGGTGG No data
1183478947_1183478951 -6 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478951 22:38052474-38052496 TGTCTTTCCTAATGGCCACCGGG No data
1183478947_1183478957 19 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478957 22:38052499-38052521 GCAGCACTTCCCCAGGAATGTGG No data
1183478947_1183478958 20 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478958 22:38052500-38052522 CAGCACTTCCCCAGGAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183478947 Original CRISPR AAGACAGCTCCTGGAGCACG CGG (reversed) Intergenic