ID: 1183478948

View in Genome Browser
Species Human (GRCh38)
Location 22:38052466-38052488
Sequence CCATTAGGAAAGACAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183478948_1183478956 3 Left 1183478948 22:38052466-38052488 CCAGGAGCTGTCTTTCCTAATGG No data
Right 1183478956 22:38052492-38052514 CCGGGTGGCAGCACTTCCCCAGG No data
1183478948_1183478958 11 Left 1183478948 22:38052466-38052488 CCAGGAGCTGTCTTTCCTAATGG No data
Right 1183478958 22:38052500-38052522 CAGCACTTCCCCAGGAATGTGGG No data
1183478948_1183478957 10 Left 1183478948 22:38052466-38052488 CCAGGAGCTGTCTTTCCTAATGG No data
Right 1183478957 22:38052499-38052521 GCAGCACTTCCCCAGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183478948 Original CRISPR CCATTAGGAAAGACAGCTCC TGG (reversed) Intergenic