ID: 1183478951

View in Genome Browser
Species Human (GRCh38)
Location 22:38052474-38052496
Sequence TGTCTTTCCTAATGGCCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183478947_1183478951 -6 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478951 22:38052474-38052496 TGTCTTTCCTAATGGCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183478951 Original CRISPR TGTCTTTCCTAATGGCCACC GGG Intergenic