ID: 1183478952

View in Genome Browser
Species Human (GRCh38)
Location 22:38052477-38052499
Sequence CTTTCCTAATGGCCACCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183478947_1183478952 -3 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478952 22:38052477-38052499 CTTTCCTAATGGCCACCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183478952 Original CRISPR CTTTCCTAATGGCCACCGGG TGG Intergenic