ID: 1183478953

View in Genome Browser
Species Human (GRCh38)
Location 22:38052481-38052503
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183478953_1183478962 17 Left 1183478953 22:38052481-38052503 CCTAATGGCCACCGGGTGGCAGC No data
Right 1183478962 22:38052521-38052543 GGCAGCAGAGCCAGCCCTTGTGG No data
1183478953_1183478957 -5 Left 1183478953 22:38052481-38052503 CCTAATGGCCACCGGGTGGCAGC No data
Right 1183478957 22:38052499-38052521 GCAGCACTTCCCCAGGAATGTGG No data
1183478953_1183478958 -4 Left 1183478953 22:38052481-38052503 CCTAATGGCCACCGGGTGGCAGC No data
Right 1183478958 22:38052500-38052522 CAGCACTTCCCCAGGAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183478953 Original CRISPR GCTGCCACCCGGTGGCCATT AGG (reversed) Intergenic