ID: 1183478956

View in Genome Browser
Species Human (GRCh38)
Location 22:38052492-38052514
Sequence CCGGGTGGCAGCACTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183478948_1183478956 3 Left 1183478948 22:38052466-38052488 CCAGGAGCTGTCTTTCCTAATGG No data
Right 1183478956 22:38052492-38052514 CCGGGTGGCAGCACTTCCCCAGG No data
1183478947_1183478956 12 Left 1183478947 22:38052457-38052479 CCGCGTGCTCCAGGAGCTGTCTT No data
Right 1183478956 22:38052492-38052514 CCGGGTGGCAGCACTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183478956 Original CRISPR CCGGGTGGCAGCACTTCCCC AGG Intergenic