ID: 1183481746

View in Genome Browser
Species Human (GRCh38)
Location 22:38069108-38069130
Sequence GGACTCACCATTGCACAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 216}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183481746_1183481760 16 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481760 22:38069147-38069169 GGCCCCGGGGACTCAAGCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 180
1183481746_1183481748 -7 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481748 22:38069124-38069146 TGAGTCCCTTCCCACCCAGCTGG 0: 1
1: 0
2: 2
3: 27
4: 194
1183481746_1183481764 29 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481764 22:38069160-38069182 CAAGCCCAGGCTGAGAAGAGTGG 0: 1
1: 0
2: 1
3: 58
4: 428
1183481746_1183481765 30 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481765 22:38069161-38069183 AAGCCCAGGCTGAGAAGAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 300
1183481746_1183481753 1 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481753 22:38069132-38069154 TTCCCACCCAGCTGGGGCCCCGG 0: 1
1: 0
2: 1
3: 43
4: 391
1183481746_1183481750 -5 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481750 22:38069126-38069148 AGTCCCTTCCCACCCAGCTGGGG 0: 1
1: 0
2: 2
3: 32
4: 259
1183481746_1183481754 2 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481754 22:38069133-38069155 TCCCACCCAGCTGGGGCCCCGGG 0: 1
1: 1
2: 4
3: 73
4: 1323
1183481746_1183481756 3 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481756 22:38069134-38069156 CCCACCCAGCTGGGGCCCCGGGG 0: 1
1: 0
2: 4
3: 26
4: 423
1183481746_1183481749 -6 Left 1183481746 22:38069108-38069130 CCATCCTGTGCAATGGTGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 216
Right 1183481749 22:38069125-38069147 GAGTCCCTTCCCACCCAGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183481746 Original CRISPR GGACTCACCATTGCACAGGA TGG (reversed) Exonic
900548987 1:3244280-3244302 GGACTGACGTGTGCACAGGACGG + Intronic
902047105 1:13533259-13533281 TCACTCACCAATGCACATGAAGG - Intergenic
903539282 1:24087632-24087654 GGCCTCCCCACTGCCCAGGAAGG - Intronic
904950546 1:34234831-34234853 GGACTGGCAGTTGCACAGGAAGG + Intergenic
905342074 1:37286182-37286204 GGACACAACAGTGAACAGGACGG - Intergenic
905635825 1:39551418-39551440 GGCCTCACTATTGCCCAGGTTGG + Intergenic
905771198 1:40639082-40639104 GGTCTAGCCATTGCACAGTACGG + Intronic
906411311 1:45581651-45581673 AGACTCACCATCGCCCAGGCTGG + Intergenic
906680879 1:47724962-47724984 GGACCCACCAGAGCCCAGGAGGG + Intergenic
912155046 1:106907958-106907980 GCACTCACCCTTGCATAGCAGGG + Intergenic
912798938 1:112709183-112709205 GGTCTCACTATTGCCCAGGGTGG + Intronic
913227988 1:116717173-116717195 GGTCTCAGCATGGCACAGCATGG + Intergenic
914673192 1:149887597-149887619 GGTGTCACCATTGCCCAGGGCGG - Exonic
914743810 1:150486556-150486578 GGTCTCACCGTTGCCCAGGCTGG - Intergenic
917335588 1:173921584-173921606 GGTCTCACTATTGCCCAGGCTGG + Intergenic
917858504 1:179122314-179122336 GGTCTCACTATTGCCCAGGCAGG + Intronic
917870691 1:179239359-179239381 GGTCTCACTATTGCCCAGGCTGG + Intergenic
920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG + Intronic
1063428977 10:5972212-5972234 GGACTCCCCACTGCACAGAAGGG + Intronic
1064273743 10:13888040-13888062 GGAGTCACGATTGCACACAAAGG - Intronic
1065474575 10:26120132-26120154 AGACTCACTGTTGCCCAGGATGG - Intronic
1067217048 10:44311681-44311703 GGTCTGCCCACTGCACAGGACGG + Intergenic
1067409304 10:46050803-46050825 GGTTTCACCATTGCCCAGGTTGG + Intergenic
1068215739 10:53979645-53979667 GGCCTCACAATTGGACAGGTTGG + Intronic
1069874363 10:71552658-71552680 GGACTCACAACTGAGCAGGAAGG + Intronic
1070253909 10:74797736-74797758 GGACTCCCCATCTCCCAGGAGGG - Intergenic
1073689340 10:105790369-105790391 AGACACACCATTGTCCAGGAGGG + Intergenic
1077656398 11:4023133-4023155 GGTTTCACCATTGCCCAGGCTGG - Intronic
1079090410 11:17476621-17476643 GCACTCACCAATGAAGAGGATGG + Exonic
1080787618 11:35490016-35490038 GGACTCACAATTCCACATGCTGG + Intronic
1081342985 11:41950380-41950402 GAACAAACCATTGCACAGCATGG + Intergenic
1081510977 11:43773079-43773101 GGTCTCACTGTTGCCCAGGATGG - Intronic
1083263919 11:61537515-61537537 GGCCTCACCCTTGCTCAGGACGG + Intronic
1083730010 11:64647819-64647841 AGACACACTATTGCACAGGGAGG - Intronic
1085484972 11:76855301-76855323 GGACTCACTGTTGCCCAGGCTGG + Intergenic
1086175065 11:83881589-83881611 GGACTAACTATTACACTGGAGGG - Intronic
1088073513 11:105818681-105818703 GCCCTCTCCAGTGCACAGGAAGG - Intronic
1089211079 11:116803306-116803328 GGTCTCACCGTTGCCCAGGATGG + Intergenic
1092368925 12:7900301-7900323 GGACTCACTGTTGCCCAGGCTGG - Intergenic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1093014902 12:14145855-14145877 GGACTCACAGTTCCACAGGACGG + Intergenic
1096321701 12:50619859-50619881 GGTCTCACTATTGCCCAGGCTGG - Intronic
1099588545 12:84554464-84554486 GGTCTCACTATTGCCCAGGCTGG + Intergenic
1099945764 12:89242494-89242516 GGAGTCTCCATTGTACAGGCTGG + Intergenic
1100101583 12:91113607-91113629 TGAATCACCATTGGCCAGGATGG - Intergenic
1100831372 12:98519237-98519259 GGAGTCTCCATTGCCCAGGTTGG + Intronic
1102905027 12:116667809-116667831 GGTCTCACTATTGCCCAGGCTGG - Intergenic
1103491523 12:121324850-121324872 GGTCTCACTGTTGCCCAGGATGG - Intronic
1103812195 12:123624286-123624308 GGTCTCACCATCGCCCAGGCTGG + Intronic
1104747022 12:131216906-131216928 GGACCCAGCACGGCACAGGAGGG + Intergenic
1104785596 12:131446279-131446301 GGACCCAGCACGGCACAGGAGGG - Intergenic
1105482040 13:20786705-20786727 GCAGTGACCATTGCAAAGGATGG + Intronic
1107452551 13:40523427-40523449 GGTTTCACCATTGGCCAGGATGG + Intergenic
1113781697 13:112981003-112981025 AGAGTCCCCAGTGCACAGGAAGG - Intronic
1113781712 13:112981067-112981089 GGGGTCCCCAGTGCACAGGAAGG - Intronic
1113781721 13:112981098-112981120 GGGGTCCCCAGTGCACAGGAAGG - Intronic
1114057469 14:18984755-18984777 GGTTTCACCATTGGACAGGATGG - Intronic
1114105075 14:19416992-19417014 GGTTTCACCATTGGACAGGATGG + Intronic
1115178187 14:30590224-30590246 GGATTCATCATTACACTGGAGGG + Intronic
1115218412 14:31035386-31035408 GGTTTCACCATTGGCCAGGATGG + Intronic
1116830862 14:49718308-49718330 GGTCTCACCTTTGCCCAGGCAGG + Intronic
1117505713 14:56401051-56401073 GGACTCACCATTGGAAGGAAGGG + Intergenic
1118712501 14:68533741-68533763 GTACTCAACATTGCTCAGAAAGG - Intronic
1119220881 14:72906235-72906257 GGACTCACCAAAGCTCAGCAAGG - Intergenic
1119233087 14:72996421-72996443 GGTCTCACTATTGCCCAGGCTGG + Intronic
1121288040 14:92751854-92751876 GGTCTCACCGTTGCCCAGGCTGG - Intergenic
1122980071 14:105187508-105187530 GGTCTCACCCTTGCCCAGGCTGG + Intergenic
1122987735 14:105220249-105220271 CGACCCACCAGTGCAGAGGAGGG - Intronic
1123497995 15:20849664-20849686 GGTTTCACCATTGGCCAGGATGG + Intronic
1123555226 15:21423292-21423314 GGTTTCACCATTGGCCAGGATGG + Intronic
1123591471 15:21860623-21860645 GGTTTCACCATTGGCCAGGATGG + Intergenic
1125998090 15:44183395-44183417 GGGCCCACCACTCCACAGGAAGG + Intronic
1128311699 15:66634912-66634934 GGTCTCACCATGTCACAGGGAGG + Intronic
1131039425 15:89249375-89249397 GATCTCACCCTTGCACAGGCTGG + Intronic
1131391354 15:92051428-92051450 GGAATCATCAGTGCACAGGGAGG + Intronic
1132275735 15:100562092-100562114 GGACTCAAGTGTGCACAGGAGGG - Intronic
1202963572 15_KI270727v1_random:150501-150523 GGTTTCACCATTGGCCAGGATGG + Intergenic
1132580709 16:683522-683544 TGCCTCACCATTGCCCAGGGAGG + Exonic
1132876618 16:2142383-2142405 GGACTCACTATTGTCCAGGCTGG - Intronic
1133191094 16:4134134-4134156 GGCCTCACCAGTGCCCAGGCAGG + Intergenic
1133575368 16:7083862-7083884 AGAGTCACCATTCCTCAGGATGG - Intronic
1135331436 16:21563209-21563231 GGTCTCACCGTTGCCCAGGCGGG - Intergenic
1136013675 16:27381533-27381555 GGATTCACCATGGCACATGCTGG - Intergenic
1136952674 16:34741052-34741074 GGAATCACCATTGAATGGGATGG - Intergenic
1138277261 16:55744104-55744126 AGACACACCTTTGCACAGGAAGG + Intergenic
1138283149 16:55787276-55787298 AGACACTCCTTTGCACAGGAAGG + Intergenic
1138285788 16:55809325-55809347 TGACACACCTTTGCACAGGAAGG - Intronic
1139815689 16:69669088-69669110 GGTCTCACTATTGCCCAGGCTGG + Intronic
1140848284 16:78910610-78910632 GGACTCACAATTCCACATGGCGG + Intronic
1144685881 17:17226084-17226106 GGAGCCAGCATTGCACAGGGAGG - Intronic
1145009330 17:19358638-19358660 GGTCTCTCCACTGCACAGGGTGG + Intronic
1146660889 17:34664654-34664676 GGACTCAGCACTTCACAGGTAGG + Intergenic
1148007279 17:44443696-44443718 GGTCTCACCATCGCCCAGGCTGG + Intronic
1149197113 17:54134239-54134261 GGCCTCACTCTTGCACAGGCTGG - Intergenic
1150342281 17:64378209-64378231 GGACTCAATACTGCATAGGATGG - Intronic
1150372093 17:64647858-64647880 GGTCTCACTGTTGCCCAGGATGG - Intronic
1153303650 18:3613359-3613381 GGACTCACTGTTGCCCAGGCTGG + Intronic
1153605912 18:6831831-6831853 GTACTCACCATTAAACATGATGG + Intronic
1154213995 18:12402063-12402085 GGAATCACCATAGCTCAGGTAGG + Intergenic
1154455995 18:14526093-14526115 GGTTTCACCATTGGCCAGGATGG + Intronic
1155888779 18:31240750-31240772 GGTCTCACCATTGCCCAGGCTGG + Intergenic
1157725798 18:49962774-49962796 GGGCTCTCCACTGCTCAGGAGGG - Intronic
1158366124 18:56738371-56738393 GGTTTCACCATTGCCCAGGCTGG - Intronic
1161791993 19:6365625-6365647 GGTCTCACCATTGCCCAGGCTGG - Intronic
1162422464 19:10573689-10573711 GGTCTCACTCTTGCCCAGGATGG + Intronic
1162554300 19:11377089-11377111 GGTCTCACTTTTGCACAGGCTGG - Intergenic
1166935484 19:46329929-46329951 GGTCTCACCATTGCCCAGGCTGG - Intronic
1167507593 19:49878992-49879014 GGTCTCAGAATTGCCCAGGACGG - Intronic
1167868130 19:52344810-52344832 GGAGTCTCCATTGCCCAGGCTGG + Intronic
1168138046 19:54364763-54364785 GGACTCACCTAGGCCCAGGAGGG + Exonic
925070543 2:964321-964343 GGAGACACCATGGGACAGGAAGG - Intronic
925720709 2:6823929-6823951 GGAGTCTCCATTGCCCAGGCTGG + Intergenic
927167222 2:20336214-20336236 GGTCTCACTATTGCCCAGGATGG + Intronic
928142075 2:28738361-28738383 GGAGTCTCTATTGCCCAGGATGG - Intergenic
928205849 2:29282866-29282888 TGACACACCAGAGCACAGGAGGG - Intronic
929492990 2:42413658-42413680 TGACTCACAGTTCCACAGGAGGG + Intronic
929890662 2:45916438-45916460 GGTCTCACTGTTGCCCAGGATGG + Intronic
931275413 2:60739903-60739925 GGACTCCACATTGCCCAGGCTGG + Intergenic
933670310 2:85001020-85001042 GGTCTCACTATTGCCCAGGCTGG + Intronic
934999507 2:98999949-98999971 GGTTTCACCATTGCCCAGGCTGG + Intronic
935243548 2:101198665-101198687 GGTCTTGCCATTGCTCAGGATGG + Intronic
936075125 2:109396950-109396972 GGACTCAGCAGTGGTCAGGAAGG - Intronic
936249360 2:110855707-110855729 GGACACAACATTACTCAGGATGG - Intronic
938283690 2:130088781-130088803 GGTTTCACCATTGGACAGGATGG + Intronic
938334333 2:130477345-130477367 GGTTTCACCATTGGACAGGATGG + Intronic
938355493 2:130643323-130643345 GGTTTCACCATTGGACAGGATGG - Intronic
938431917 2:131250112-131250134 GGTTTCACCATTGGACAGGATGG - Intronic
938475589 2:131608737-131608759 GGTTTCACCATTGGACAGGATGG - Intergenic
940521732 2:154759296-154759318 GGACTCTCCAATGCACCAGAAGG + Intronic
940982830 2:160022657-160022679 GGACTCACCATCTCCAAGGAGGG + Exonic
943326312 2:186502340-186502362 GGTCTCACTGTTGCTCAGGATGG - Intronic
945145755 2:206736369-206736391 GGACTCACAGTTCCACAGGGTGG + Intergenic
946027587 2:216681170-216681192 GTGCTAACCATTGCACAGAAGGG + Intronic
946034512 2:216731182-216731204 GGACTCAACCTGGCAGAGGAGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948819514 2:240532901-240532923 GGTCTCACTATTGCTCAGGCTGG + Intronic
948852060 2:240713332-240713354 GGCCGCACCATTGCACACGAGGG - Intergenic
1169844519 20:9975069-9975091 GGACTCACAATCACAGAGGAAGG - Intergenic
1172334746 20:34105949-34105971 GGTCTCACTGTTGCCCAGGATGG + Intronic
1173266166 20:41484344-41484366 TGACTCACCATTGATCAGGTAGG + Exonic
1173797725 20:45874184-45874206 GGTCTCACCGTTGCCCAGGTTGG - Intronic
1174458439 20:50666002-50666024 GGACTCAGCATTACAAGGGATGG - Intronic
1174469461 20:50745527-50745549 GGTCTCACCATTGCCCAGATTGG + Intronic
1174684740 20:52443315-52443337 TAAATCACCATTTCACAGGAAGG - Intergenic
1175652059 20:60733981-60734003 GGACTGACTCTTGCACAGGAGGG + Intergenic
1176053221 20:63131480-63131502 GGCCTCACCAGAGCACAGGGTGG + Intergenic
1176818167 21:13627247-13627269 GGTTTCACCATTGGCCAGGATGG - Intronic
1177679839 21:24352694-24352716 GGAATCAACCTTGGACAGGATGG + Intergenic
1177897171 21:26867356-26867378 GGACTCAGCCTTCCACAGTAAGG - Intergenic
1179231332 21:39506503-39506525 GGACTCACCGTTCCACATGGCGG + Intronic
1179792283 21:43762584-43762606 GGCCTCAGAATTGCACAGGGAGG - Intergenic
1180475959 22:15707364-15707386 GGTTTCACCATTGGACAGGATGG - Intronic
1180977937 22:19860753-19860775 GGTCTCACTCTTGCACAGGCTGG - Intergenic
1181280683 22:21717929-21717951 GGTCTCACTGTTGCACAGGCTGG - Intronic
1181283140 22:21734188-21734210 GGTCTCACTCTTGCTCAGGATGG - Intronic
1181518978 22:23434542-23434564 GGTCTCCCCATTTCACAGGTGGG + Intergenic
1181775029 22:25153399-25153421 GGATCCCACATTGCACAGGACGG + Intronic
1182248672 22:28981965-28981987 GGAGTCTCCATTGCCCAGGCTGG - Intronic
1183481746 22:38069108-38069130 GGACTCACCATTGCACAGGATGG - Exonic
1183657412 22:39195726-39195748 GTTCTCACCATTGCCCAGGGTGG - Intergenic
1183808399 22:40232952-40232974 GGTTTCACCATTGGCCAGGATGG - Intronic
1184099801 22:42336109-42336131 GAACTCCTCATTGCAGAGGATGG + Intronic
1184535323 22:45082722-45082744 GGTCTCACCATTGCACATGCTGG - Intergenic
949358064 3:3202648-3202670 GGTCTCACTATTGCCCAGGCTGG - Intergenic
954086271 3:48246275-48246297 GGTCTCACTATTGCCCAGGCTGG - Intronic
954115990 3:48467079-48467101 GGCCTCACCAGTGCTCTGGATGG + Exonic
955177208 3:56628788-56628810 GGTCTCACCATTGCCCAGGCTGG + Intronic
956963408 3:74430545-74430567 GGTCTCACTATTGCCCAGGCTGG - Intronic
958022314 3:88012277-88012299 GGTCTCACTATTGCCCAGGCTGG - Intergenic
958944574 3:100349141-100349163 GGTCTTACCATTGCCCAGGCTGG + Intronic
964312962 3:155413983-155414005 GGTCTCACTGTTGCACAGGCTGG + Intronic
968789477 4:2649640-2649662 GGTCTCACTGTTGCCCAGGATGG - Intronic
971560491 4:28074019-28074041 GGTGTCCCCAGTGCACAGGATGG - Intergenic
971784307 4:31081015-31081037 GGACTCACATTTCCACAGGTTGG - Intronic
972596895 4:40537445-40537467 GGTTTCACCATTGCCCAGGCTGG + Intronic
972817624 4:42661296-42661318 GGTCTCAACATTGCTCAGGCTGG - Intergenic
974015172 4:56642778-56642800 GGTCTCACTATTGCCCAGGCTGG + Intergenic
977557634 4:98500970-98500992 GGACTCAGCTTTTCAGAGGAGGG - Intronic
978783752 4:112585238-112585260 GGTCTCACTGTTGCCCAGGATGG - Intronic
983645131 4:169981874-169981896 GTACTCACCATTGCTCCAGAAGG - Intergenic
984834431 4:184006656-184006678 GGTCTCACCCTTGCGCAGGCTGG - Intronic
985882884 5:2653886-2653908 GGACTCACCCTTACACACAAAGG - Intergenic
986242414 5:5972918-5972940 GGACTCACCAAAGCAGGGGAAGG + Intergenic
990975406 5:61556229-61556251 GGTCTCTCCATTGCCCAGGCTGG - Intergenic
991431949 5:66557562-66557584 GGACTCACTATTGCTCAGGCTGG + Intergenic
992509535 5:77419359-77419381 GGGATTCCCATTGCACAGGATGG - Intronic
994153167 5:96473361-96473383 GGGCTCAGAATTGCACTGGATGG + Intergenic
994174895 5:96700954-96700976 GGTCTCACTATTGCCCAGGCAGG + Intronic
995392961 5:111659874-111659896 GGACTCACAGTTCCACAGGCTGG + Intergenic
998526308 5:142846336-142846358 GGAGTCACCAGTGCATAGGTGGG + Intronic
999518837 5:152329682-152329704 TGCCTCACCATTTCACTGGAAGG - Intergenic
999748051 5:154607233-154607255 GGACCCACCCTGGCACAGGTAGG + Intergenic
1001824683 5:174735494-174735516 GGAGTGACCCTTGCGCAGGAAGG + Intergenic
1002525588 5:179814098-179814120 GGAGTCAGTATTGCACAGGCTGG - Intronic
1003347653 6:5285536-5285558 GGACTCATCTTTGCACATGGTGG + Intronic
1004994720 6:21178820-21178842 GGACTTACCTAAGCACAGGAGGG + Intronic
1006308311 6:33238814-33238836 GGTCTCACTATTGCTCAGGCTGG + Intergenic
1006327335 6:33364583-33364605 GGTCTTACCATTGCCCAGGCTGG + Intergenic
1008606239 6:53142396-53142418 AGAGCCACCAATGCACAGGATGG + Intronic
1009036134 6:58119106-58119128 AGACACACCATTTCACAGAAAGG + Intergenic
1009211951 6:60872725-60872747 AGACACACCATTTCACAGAAAGG + Intergenic
1009380766 6:63026098-63026120 GTGCTTACCACTGCACAGGATGG - Intergenic
1010010028 6:71038657-71038679 GGTATCACCATTGTACAGTATGG - Intergenic
1015139289 6:129911544-129911566 GATCTCACCATTACACAGCATGG - Intergenic
1017179212 6:151534248-151534270 GGTCTCACTGTTGCACAGGCTGG + Intronic
1019586510 7:1807288-1807310 GGTCTCACTATTGCCCAGGCTGG - Intergenic
1019592308 7:1841784-1841806 GGTCTCCCCATTTCACAGGTGGG - Intronic
1019835915 7:3383213-3383235 GGTCTCACTATTGCCCAGGCTGG - Intronic
1025148326 7:56524342-56524364 GGTCTCACTATTGCCCAGGCTGG + Intergenic
1025152827 7:56573794-56573816 GGACTCAGCATTGCTGAGGATGG + Intergenic
1026166654 7:67916117-67916139 GGACTCACTGTTGCACAGGCTGG + Intergenic
1027370473 7:77504599-77504621 GGTCTCACTGTTGCACAGGCTGG + Intergenic
1029492720 7:100881150-100881172 GGTCTCACTATTGCCCAGGTTGG + Intronic
1030857662 7:114581375-114581397 GGTTTCACCATTGCCCAGGCTGG + Intronic
1033932932 7:146546674-146546696 GGACTCACAGTTCCACATGAGGG + Intronic
1034920741 7:155079146-155079168 GGTCTCTCTATTGCACAGGCTGG + Intronic
1035680942 8:1487719-1487741 GGACGCAGCAGTGCACAGGTGGG - Intergenic
1039273657 8:35910964-35910986 GGACTCACAGTTCCACAGGCTGG + Intergenic
1040071544 8:43192725-43192747 GGTCTCACTATTGCACAGGCTGG - Intronic
1040437650 8:47408294-47408316 GGTCTCACCGTTGCCCAGGCTGG + Intronic
1040460004 8:47638337-47638359 GGTCTCACTATTGCCCAGGCTGG + Intronic
1041968784 8:63712617-63712639 GGACTCACAATTCCACATGGTGG - Intergenic
1043477698 8:80621487-80621509 GGCCTCACTATTGCCCAGGCTGG + Intergenic
1044679927 8:94767038-94767060 GGTCTCACCGTTGCCCAGGCTGG - Intronic
1044982257 8:97728724-97728746 GGTCTCTCTATTGCTCAGGATGG - Exonic
1049846454 8:144804224-144804246 GTACTCACCTGTGCACAGGCTGG - Exonic
1055122787 9:72682042-72682064 GGACTCACCAATCCAAAAGAGGG - Intronic
1059315841 9:113425252-113425274 GGAGTCACCATTGTGAAGGAAGG + Intronic
1060239677 9:121892352-121892374 GGACTCACAATTCCACATGGGGG + Intronic
1062069163 9:134546193-134546215 GGAAACACCAAGGCACAGGACGG - Intergenic
1062415998 9:136450444-136450466 GGTCTCACTATTGCCCAGGCTGG - Intronic
1203529192 Un_GL000213v1:122257-122279 GGTTTCACCATTGGCCAGGATGG + Intergenic
1186152313 X:6688436-6688458 CGTCTCACCATGGCACAGGAGGG + Intergenic
1186491286 X:9975220-9975242 GGTCTCACTATTGCCCAGGCTGG + Intergenic
1188467338 X:30496966-30496988 GGCCTGGCCATTGAACAGGATGG + Intergenic
1188594336 X:31879189-31879211 GGACTCACCATTCTACATGGCGG + Intronic
1191115422 X:56847133-56847155 GAACTCGCCATAGCACAGCAAGG + Intergenic
1193012183 X:76688371-76688393 TGACTCCCCAGTGCACAAGAAGG - Intergenic
1196090353 X:111734418-111734440 GGGCTCACCTTTTCACAGTAAGG + Intronic
1198392392 X:136189306-136189328 GGACTCAACATGGGTCAGGAGGG - Intronic
1198422671 X:136483065-136483087 AGTCTCACCTGTGCACAGGATGG - Intergenic
1198708952 X:139480483-139480505 GGACTTAACATTGGAAAGGAGGG - Intergenic
1199757384 X:150877787-150877809 GGACTCACTGTTGCCCAGGCTGG - Intronic
1200747899 Y:6918432-6918454 GGTCTCACTGTTGCACAGGCTGG + Intronic