ID: 1183482126

View in Genome Browser
Species Human (GRCh38)
Location 22:38070877-38070899
Sequence CTGAGCTATACAAAGGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183482116_1183482126 24 Left 1183482116 22:38070830-38070852 CCCGACAGATGGGCTTGTCAAGA 0: 1
1: 0
2: 2
3: 9
4: 101
Right 1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 117
1183482117_1183482126 23 Left 1183482117 22:38070831-38070853 CCGACAGATGGGCTTGTCAAGAG 0: 1
1: 0
2: 1
3: 12
4: 99
Right 1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183482126 Original CRISPR CTGAGCTATACAAAGGTGGG TGG Exonic
900722777 1:4188404-4188426 CTGAGAACTCCAAAGGTGGGGGG - Intergenic
902371218 1:16008240-16008262 CTAAGCTATACAAAAGGGTGGGG + Exonic
904366149 1:30012038-30012060 CAGAGCTTTAAACAGGTGGGAGG + Intergenic
904596398 1:31648731-31648753 CTGAGGCAGACAGAGGTGGGTGG + Intergenic
904891647 1:33783940-33783962 CTATACTATAAAAAGGTGGGTGG + Intronic
904891720 1:33784356-33784378 CTCTACTATAAAAAGGTGGGTGG - Intronic
906067836 1:42994893-42994915 CTGGGATATAGAATGGTGGGAGG + Intergenic
907255246 1:53173943-53173965 CTGAGCTGGAGACAGGTGGGAGG + Intergenic
907664740 1:56424970-56424992 GTGAGGCATACAAAAGTGGGTGG - Intergenic
907789845 1:57652024-57652046 ATTAGCTTTACAAAGGTGGTTGG - Intronic
908062391 1:60365817-60365839 ATGGGCTATACAAAAGCGGGTGG - Intergenic
908747507 1:67390350-67390372 CTGAGGTATAAAAAGCTAGGGGG - Intronic
909555376 1:76948201-76948223 CTGATGCATGCAAAGGTGGGGGG - Intronic
915486129 1:156222010-156222032 CTGAGCTGTAGACTGGTGGGAGG - Intronic
916412384 1:164559177-164559199 CTGAGCTAAACAAAAGCAGGAGG + Intronic
921257315 1:213354329-213354351 CTGAGCTCTACAAAAGTGCAGGG - Intergenic
924466381 1:244302475-244302497 CTGAGCTGCACAGAGGTGGTGGG + Intergenic
1064531647 10:16316516-16316538 CTGAGATATATAAAGCTTGGTGG - Intergenic
1066547704 10:36518805-36518827 CTGAGAACCACAAAGGTGGGTGG - Intergenic
1070857656 10:79620034-79620056 CTCAGAGGTACAAAGGTGGGAGG - Intergenic
1076225979 10:128775727-128775749 CTGAACTGTAATAAGGTGGGAGG - Intergenic
1079637474 11:22762010-22762032 CTGGGGGATAAAAAGGTGGGAGG - Intronic
1080075323 11:28140907-28140929 CTGGACCAAACAAAGGTGGGAGG + Intronic
1080337844 11:31219670-31219692 CTGTGCTCGACAAAGGTGGCAGG + Intronic
1081329476 11:41786742-41786764 CTGATCTCAACAAAGGTGGGAGG - Intergenic
1081516120 11:43831943-43831965 CTCATCTGTACAATGGTGGGAGG - Intronic
1082196904 11:49317193-49317215 CTGTGCTATAAAGAGATGGGGGG - Intergenic
1084898916 11:72295224-72295246 CAGAGCTACACCAGGGTGGGGGG - Intronic
1086966277 11:93031570-93031592 CAGAGCTATACCAGGGTGGGCGG + Intergenic
1087294543 11:96355378-96355400 CTCAGCTATACTAAGATAGGAGG + Intronic
1092234354 12:6796949-6796971 CTGAGGTGTGCAAAGGTGGTAGG - Intronic
1092736405 12:11587184-11587206 CTGAGCTATCCCAATGTAGGGGG - Intergenic
1094596164 12:31868563-31868585 TTGCCCTGTACAAAGGTGGGGGG - Intergenic
1100392519 12:94156429-94156451 CTGAGGCATACTCAGGTGGGAGG - Intronic
1101442487 12:104714044-104714066 CTGAGCTATGCTTAGGTGGGAGG - Intronic
1104201409 12:126593278-126593300 CTTAGGTATACAAGGGTGAGGGG - Intergenic
1105788998 13:23779386-23779408 ATCAGCTAGAAAAAGGTGGGAGG + Intronic
1108467548 13:50732136-50732158 CTGTGTTATAGAAACGTGGGTGG - Intronic
1109574730 13:64240093-64240115 CAGAGATTTACAAATGTGGGGGG + Intergenic
1113875646 13:113593006-113593028 CTCAGCTATACACAGGTGTCAGG + Intronic
1113875692 13:113593245-113593267 CTCAGCTATACACAGGTGTCAGG + Intronic
1113875806 13:113593797-113593819 CTCAGCTATACACAGGTGTCAGG + Intronic
1113875921 13:113594350-113594372 CTCAGCTATACACAGGTGTCAGG + Intronic
1115171060 14:30507563-30507585 CTGAGAGATACAAGGGTAGGAGG - Intergenic
1121461198 14:94080054-94080076 CTCATCTATAAAAAGGGGGGAGG + Intronic
1121517571 14:94562901-94562923 CTGACCTCTACAGGGGTGGGAGG + Intronic
1122879172 14:104682337-104682359 CTGAGCTCTTCCAGGGTGGGAGG - Intergenic
1127682944 15:61315292-61315314 CTGAGCTATAAAAATGTGGGCGG - Intergenic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1133253675 16:4502580-4502602 CTGAGCTATCTAGAGGAGGGAGG - Intronic
1133527928 16:6624510-6624532 CTAACCAAAACAAAGGTGGGTGG - Intronic
1134942598 16:18300752-18300774 CTGAGCCATACAAAAGCAGGTGG - Intergenic
1144176816 17:12715416-12715438 CTGAGCTATGCACAGTAGGGAGG - Intronic
1146682457 17:34817948-34817970 CTGAGCTAGACATAGGAGGGAGG - Intergenic
1150286899 17:63959787-63959809 CTGATCTCTACAATGTTGGGAGG + Intronic
1152260314 17:79263184-79263206 CTGAGCCCTCCAAAGGTTGGGGG - Intronic
1153161470 18:2209223-2209245 TTGTGCTATACAAAGGCGAGTGG + Intergenic
1154112477 18:11582006-11582028 CTGGGCTGTACAACAGTGGGGGG - Intergenic
1155103606 18:22639052-22639074 GTGATCTATACAAATGTGGAAGG - Intergenic
1158845770 18:61441175-61441197 GTGAGTTATACAAAGGTGAGAGG - Intronic
1159061064 18:63514349-63514371 CTGAGGTGTACAAAGGTAAGAGG - Intergenic
1160099224 18:75904698-75904720 CTTAGCTTAACAAAGGTGAGTGG + Intergenic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
930691071 2:54365203-54365225 CTGAGCTATGCACAGGAGTGGGG + Intronic
931722003 2:65073354-65073376 CTGGGCTAAACAAAGGTAAGTGG + Intronic
933198332 2:79418331-79418353 ATTAGCTTTACAAAGGTGGTTGG + Intronic
936466496 2:112756279-112756301 CTGAGGTATACAAACTTGGCTGG + Exonic
937245403 2:120489176-120489198 CAGAGCAAGACAAAAGTGGGAGG + Intergenic
947524904 2:230871880-230871902 CTGTGCTCTAAAAGGGTGGGAGG + Intronic
1172538767 20:35694984-35695006 CTGAGATAAAATAAGGTGGGTGG - Intronic
1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG + Intronic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1175000523 20:55623693-55623715 CTGAGCTATGCAAAGCTCAGGGG - Intergenic
1179094359 21:38299088-38299110 CTGATCTATACTTAGGTGGTCGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1182092032 22:27602525-27602547 GTGAGATATCCAGAGGTGGGCGG + Intergenic
1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG + Exonic
1184569251 22:45311431-45311453 CTGAGCTGAAGGAAGGTGGGAGG + Intronic
949977609 3:9475465-9475487 AGGAGCTAGACAAAGTTGGGAGG - Exonic
950808475 3:15628900-15628922 CTGATTTAAAAAAAGGTGGGGGG - Intronic
952638575 3:35562620-35562642 CTGAGATATACAAGACTGGGTGG - Intergenic
959857445 3:111175611-111175633 CTGAGCTCTACAGAGGTGAATGG - Intronic
960649485 3:119930816-119930838 ATGAGCTATACAAAGTAGAGTGG - Intronic
962951235 3:140220975-140220997 CTGAGCCTGACAATGGTGGGTGG - Intronic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
970297996 4:14651970-14651992 CTGAGCTATGCAAGGGTGACAGG + Intergenic
971034863 4:22682167-22682189 CTGAGCTATAAAAATGAGGGAGG - Intergenic
974241916 4:59260301-59260323 AAGAGCTATAAAAATGTGGGAGG + Intergenic
975027964 4:69576204-69576226 CTGAGCTAGACAAAGAGGGCGGG + Intergenic
975142026 4:70928031-70928053 CTGAGCTAAAGAAATGGGGGTGG - Intronic
977974392 4:103247154-103247176 CTGAGCCATACATAAATGGGTGG + Intergenic
979169948 4:117588864-117588886 CTGATCTTTACAGAGTTGGGTGG - Intergenic
982735878 4:159006456-159006478 ATTAGCTATAGAAAGCTGGGGGG - Intronic
983370132 4:166847749-166847771 CTGACCTATACAGAGATGGCTGG - Intronic
984727138 4:183032259-183032281 CTGACTTAAACAAAAGTGGGAGG - Intergenic
986003240 5:3646857-3646879 CTGGGCTCTACAAAGAAGGGAGG + Intergenic
986236642 5:5916720-5916742 CTGAGGTATACACAGGTGTATGG - Intergenic
991541067 5:67728617-67728639 CTGAGCTATAAAAACATGAGAGG + Intergenic
993793937 5:92243171-92243193 ATCAGCTATACAAAGGTAAGTGG + Intergenic
994853934 5:105091745-105091767 CTGAGCTACTTAAAGTTGGGGGG - Intergenic
994897180 5:105721408-105721430 CTGAGCTGAACAAGGGTGGAAGG + Intergenic
998397822 5:141830665-141830687 CTGAACTATTCAAAGATGAGTGG - Intergenic
999370508 5:151052318-151052340 CTGAGCTAGAGGATGGTGGGGGG + Intronic
1001150063 5:169219572-169219594 CTGAGCTGTGCAGAGGTGGCAGG + Intronic
1001742370 5:174064682-174064704 ATGAGAAAAACAAAGGTGGGGGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007573137 6:42907605-42907627 GGGAGCTAGACCAAGGTGGGGGG + Intergenic
1010366093 6:75052984-75053006 TTGTGATATACAAAGGTGGCAGG - Intergenic
1012431883 6:99172523-99172545 CTGAGCCATAAAAAGGGAGGAGG + Intergenic
1012664937 6:101956537-101956559 CGGAGCTATGAAAAGGTAGGAGG - Intronic
1016984772 6:149887024-149887046 CTGAGCTGAACAGAAGTGGGAGG - Intronic
1027704774 7:81515633-81515655 CTGAGCTATTCAATTGTAGGAGG - Intergenic
1028999072 7:97134092-97134114 CTGAGCTTTGGAAAGGGGGGAGG - Intronic
1038153641 8:24965992-24966014 CAGAGCTATCCAAAGGTGGAAGG + Intergenic
1039910256 8:41820842-41820864 CTGAGCTACACAAAGGAAGAGGG + Intronic
1041168694 8:55117946-55117968 CTCAGCTATAAAATGTTGGGTGG + Intronic
1045318348 8:101062571-101062593 CTGAGCTCTTCAAATGTGGCTGG + Intergenic
1048803370 8:138215783-138215805 CTGAGCCATTCATGGGTGGGAGG - Intronic
1048854451 8:138674359-138674381 CTGAGCTAAGCAAAGGTGTGTGG - Intronic
1055191381 9:73529051-73529073 CCTATCTATACATAGGTGGGTGG - Intergenic
1056410431 9:86320998-86321020 CTGGGCTATGTAAAGGTTGGTGG - Intronic
1058854142 9:109043629-109043651 CTGAGCTACCAAAAGGAGGGAGG - Intronic
1059239640 9:112793244-112793266 CTGAGCTCTACTGAGATGGGGGG - Intronic
1185596205 X:1308519-1308541 CTGAGCTGGAGAGAGGTGGGTGG - Intronic
1186454323 X:9699267-9699289 CTGAGTTACACAGAGGAGGGAGG - Intronic
1191668130 X:63724282-63724304 GTGATTTGTACAAAGGTGGGAGG + Intronic